Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Phip'

230317

Institutional Source

Beutler Lab

Gene Symbol

Phip

Ensembl Gene

ENSMUSG00000032253

Gene Name

pleckstrin homology domain interacting protein

Synonyms

Wdr11, 2810004D21Rik, 4632404O06Rik, Ndrp

MMRRC Submission

040101-MU

Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82866159-82975516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82915339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 537 (H537R)

Ref Sequence

ENSEMBL: ENSMUSP00000034787 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034787]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034787
AA Change: H537R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: H537R

Domain	Start	End	E-Value	Type
WD40	172	211	1.5e-8	SMART
WD40	214	253	4.1e-9	SMART
WD40	256	299	3.5e-7	SMART
WD40	310	349	1.4e-1	SMART
WD40	354	393	6.6e-10	SMART
WD40	408	452	1.4e-2	SMART
WD40	455	495	3.4e-10	SMART
WD40	498	542	6.6e-2	SMART
low complexity region	802	813	N/A	INTRINSIC
low complexity region	841	854	N/A	INTRINSIC
low complexity region	865	877	N/A	INTRINSIC
coiled coil region	881	907	N/A	INTRINSIC
low complexity region	928	941	N/A	INTRINSIC
BROMO	1158	1261	3.5e-11	SMART
BROMO	1318	1423	4.1e-30	SMART
low complexity region	1438	1463	N/A	INTRINSIC
low complexity region	1500	1513	N/A	INTRINSIC
low complexity region	1708	1721	N/A	INTRINSIC
low complexity region	1752	1758	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186089

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186099

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187021

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188868

Predicted Effect

probably benign
Transcript: ENSMUST00000190822

Meta Mutation Damage Score

0.4974

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]

Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Phip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Phip	APN	9	82871303	missense	probably damaging	0.99
IGL01510:Phip	APN	9	82913871	missense	probably benign	0.01
IGL01916:Phip	APN	9	82890469	missense	possibly damaging	0.61
IGL02068:Phip	APN	9	82945808	missense	probably damaging	1.00
IGL02089:Phip	APN	9	82871319	missense	probably damaging	1.00
IGL02121:Phip	APN	9	82893370	missense	probably damaging	1.00
IGL02132:Phip	APN	9	82881341	missense	possibly damaging	0.91
IGL02146:Phip	APN	9	82881718	missense	probably benign	0.05
IGL02282:Phip	APN	9	82913690	missense	probably benign	0.09
IGL02341:Phip	APN	9	82932883	missense	probably damaging	1.00
IGL02342:Phip	APN	9	82886692	missense	probably damaging	1.00
IGL02470:Phip	APN	9	82890454	missense	possibly damaging	0.69
IGL02585:Phip	APN	9	82903188	missense	probably benign	0.03
IGL03271:Phip	APN	9	82884824	splice site	probably benign
3-1:Phip	UTSW	9	82886671	missense	probably damaging	1.00
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0102:Phip	UTSW	9	82905792	splice site	probably null
R0137:Phip	UTSW	9	82927191	splice site	probably null
R0268:Phip	UTSW	9	82871288	missense	probably damaging	1.00
R0366:Phip	UTSW	9	82926407	missense	probably damaging	1.00
R0421:Phip	UTSW	9	82926457	missense	probably damaging	1.00
R0481:Phip	UTSW	9	82876716	splice site	probably benign
R0883:Phip	UTSW	9	82876221	missense	probably benign	0.01
R0885:Phip	UTSW	9	82875395	missense	probably benign	0.06
R1300:Phip	UTSW	9	82876747	missense	probably benign	0.00
R1434:Phip	UTSW	9	82959605	missense	probably damaging	0.99
R1448:Phip	UTSW	9	82915423	missense	possibly damaging	0.92
R1588:Phip	UTSW	9	82900828	missense	probably damaging	1.00
R1619:Phip	UTSW	9	82871449	missense	probably benign	0.20
R1658:Phip	UTSW	9	82871498	missense	probably benign
R1688:Phip	UTSW	9	82871657	missense	probably benign
R1773:Phip	UTSW	9	82876189	missense	probably benign
R1865:Phip	UTSW	9	82945792	missense	probably damaging	1.00
R1934:Phip	UTSW	9	82903182	missense	probably benign	0.11
R2070:Phip	UTSW	9	82875299	missense	probably benign
R2096:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2099:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2192:Phip	UTSW	9	82871815	missense	probably damaging	0.99
R2402:Phip	UTSW	9	82875305	missense	probably benign
R2447:Phip	UTSW	9	82915399	missense	probably damaging	0.99
R2504:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2507:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R2508:Phip	UTSW	9	82915339	missense	possibly damaging	0.95
R3706:Phip	UTSW	9	82900743	missense	probably benign	0.02
R3829:Phip	UTSW	9	82871645	missense	probably benign
R3846:Phip	UTSW	9	82876126	nonsense	probably null
R4301:Phip	UTSW	9	82959713	nonsense	probably null
R4366:Phip	UTSW	9	82900869	intron	probably benign
R4748:Phip	UTSW	9	82908869	missense	probably benign	0.01
R4895:Phip	UTSW	9	82959595	missense	probably benign	0.20
R5001:Phip	UTSW	9	82896019	splice site	probably null
R5094:Phip	UTSW	9	82871844	missense	probably benign
R5181:Phip	UTSW	9	82871190	utr 3 prime	probably benign
R5194:Phip	UTSW	9	82908862	missense	probably benign	0.03
R5291:Phip	UTSW	9	82945883	missense	probably damaging	1.00
R5335:Phip	UTSW	9	82900756	missense	possibly damaging	0.93
R5458:Phip	UTSW	9	82926500	missense	probably benign	0.40
R5704:Phip	UTSW	9	82871355	missense	probably damaging	0.97
R5866:Phip	UTSW	9	82890150	missense	probably benign
R5870:Phip	UTSW	9	82908677	splice site	probably benign
R5890:Phip	UTSW	9	82906952	missense	probably benign	0.00
R6232:Phip	UTSW	9	82903181	missense	probably benign
R6379:Phip	UTSW	9	82913857	missense	probably damaging	0.98
R6653:Phip	UTSW	9	82900741	nonsense	probably null
R7129:Phip	UTSW	9	82877300	missense	probably damaging	0.98
R7290:Phip	UTSW	9	82871293	missense	possibly damaging	0.94
R7598:Phip	UTSW	9	82905658	missense	possibly damaging	0.94
R7632:Phip	UTSW	9	82903190	missense	probably benign
R7752:Phip	UTSW	9	82890150	missense	probably benign
R7827:Phip	UTSW	9	82908833	missense	probably benign
R7901:Phip	UTSW	9	82890150	missense	probably benign
R7960:Phip	UTSW	9	82893348	missense	probably benign	0.00
R8006:Phip	UTSW	9	82890126	missense	possibly damaging	0.93
R8066:Phip	UTSW	9	82875298	missense	probably benign	0.05
R8080:Phip	UTSW	9	82887609	missense	probably damaging	1.00
R8135:Phip	UTSW	9	82930374	missense	probably benign	0.09
R8347:Phip	UTSW	9	82908763	missense	probably benign	0.02
R8459:Phip	UTSW	9	82876053	missense	probably benign
R8705:Phip	UTSW	9	82893559	missense	probably damaging	0.99
R8706:Phip	UTSW	9	82905712	missense	possibly damaging	0.89
R8743:Phip	UTSW	9	82927087	missense	probably benign	0.18
R8801:Phip	UTSW	9	82876252	missense	probably benign	0.22
R8930:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8932:Phip	UTSW	9	82906988	missense	possibly damaging	0.67
R8969:Phip	UTSW	9	82926964	intron	probably benign
R9064:Phip	UTSW	9	82871487	missense	probably benign	0.20
R9332:Phip	UTSW	9	82875359	missense	probably damaging	0.98
R9335:Phip	UTSW	9	82932926	missense	probably benign	0.03
R9520:Phip	UTSW	9	82871384	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTTTTAAGATAGGACTCCTTGAGCTG -3'
(R):5'- TCTCTGGGTGGGAGGAGAAATC -3'

Sequencing Primer
(F):5'- GAGTGCACGTGCTTATCAAATCC -3'
(R):5'- TGCACAAATTTTACTGTACTCTGC -3'

Posted On

2014-09-18