Incidental Mutation 'R2097:Phip'
ID 230317
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Name pleckstrin homology domain interacting protein
Synonyms Ndrp, 4632404O06Rik, Wdr11, 2810004D21Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 82748212-82857569 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82797392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 537 (H537R)
Ref Sequence ENSEMBL: ENSMUSP00000034787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000034787
AA Change: H537R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: H537R

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188868
Predicted Effect probably benign
Transcript: ENSMUST00000190822
Meta Mutation Damage Score 0.4974 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82,753,356 (GRCm39) missense probably damaging 0.99
IGL01510:Phip APN 9 82,795,924 (GRCm39) missense probably benign 0.01
IGL01916:Phip APN 9 82,772,522 (GRCm39) missense possibly damaging 0.61
IGL02068:Phip APN 9 82,827,861 (GRCm39) missense probably damaging 1.00
IGL02089:Phip APN 9 82,753,372 (GRCm39) missense probably damaging 1.00
IGL02121:Phip APN 9 82,775,423 (GRCm39) missense probably damaging 1.00
IGL02132:Phip APN 9 82,763,394 (GRCm39) missense possibly damaging 0.91
IGL02146:Phip APN 9 82,763,771 (GRCm39) missense probably benign 0.05
IGL02282:Phip APN 9 82,795,743 (GRCm39) missense probably benign 0.09
IGL02341:Phip APN 9 82,814,936 (GRCm39) missense probably damaging 1.00
IGL02342:Phip APN 9 82,768,745 (GRCm39) missense probably damaging 1.00
IGL02470:Phip APN 9 82,772,507 (GRCm39) missense possibly damaging 0.69
IGL02585:Phip APN 9 82,785,241 (GRCm39) missense probably benign 0.03
IGL03271:Phip APN 9 82,766,877 (GRCm39) splice site probably benign
3-1:Phip UTSW 9 82,768,724 (GRCm39) missense probably damaging 1.00
R0102:Phip UTSW 9 82,787,845 (GRCm39) splice site probably null
R0102:Phip UTSW 9 82,787,845 (GRCm39) splice site probably null
R0137:Phip UTSW 9 82,809,244 (GRCm39) splice site probably null
R0268:Phip UTSW 9 82,753,341 (GRCm39) missense probably damaging 1.00
R0366:Phip UTSW 9 82,808,460 (GRCm39) missense probably damaging 1.00
R0421:Phip UTSW 9 82,808,510 (GRCm39) missense probably damaging 1.00
R0481:Phip UTSW 9 82,758,769 (GRCm39) splice site probably benign
R0883:Phip UTSW 9 82,758,274 (GRCm39) missense probably benign 0.01
R0885:Phip UTSW 9 82,757,448 (GRCm39) missense probably benign 0.06
R1300:Phip UTSW 9 82,758,800 (GRCm39) missense probably benign 0.00
R1434:Phip UTSW 9 82,841,658 (GRCm39) missense probably damaging 0.99
R1448:Phip UTSW 9 82,797,476 (GRCm39) missense possibly damaging 0.92
R1588:Phip UTSW 9 82,782,881 (GRCm39) missense probably damaging 1.00
R1619:Phip UTSW 9 82,753,502 (GRCm39) missense probably benign 0.20
R1658:Phip UTSW 9 82,753,551 (GRCm39) missense probably benign
R1688:Phip UTSW 9 82,753,710 (GRCm39) missense probably benign
R1773:Phip UTSW 9 82,758,242 (GRCm39) missense probably benign
R1865:Phip UTSW 9 82,827,845 (GRCm39) missense probably damaging 1.00
R1934:Phip UTSW 9 82,785,235 (GRCm39) missense probably benign 0.11
R2070:Phip UTSW 9 82,757,352 (GRCm39) missense probably benign
R2096:Phip UTSW 9 82,797,392 (GRCm39) missense possibly damaging 0.95
R2099:Phip UTSW 9 82,797,392 (GRCm39) missense possibly damaging 0.95
R2192:Phip UTSW 9 82,753,868 (GRCm39) missense probably damaging 0.99
R2402:Phip UTSW 9 82,757,358 (GRCm39) missense probably benign
R2447:Phip UTSW 9 82,797,452 (GRCm39) missense probably damaging 0.99
R2504:Phip UTSW 9 82,797,392 (GRCm39) missense possibly damaging 0.95
R2507:Phip UTSW 9 82,797,392 (GRCm39) missense possibly damaging 0.95
R2508:Phip UTSW 9 82,797,392 (GRCm39) missense possibly damaging 0.95
R3706:Phip UTSW 9 82,782,796 (GRCm39) missense probably benign 0.02
R3829:Phip UTSW 9 82,753,698 (GRCm39) missense probably benign
R3846:Phip UTSW 9 82,758,179 (GRCm39) nonsense probably null
R4301:Phip UTSW 9 82,841,766 (GRCm39) nonsense probably null
R4366:Phip UTSW 9 82,782,922 (GRCm39) intron probably benign
R4748:Phip UTSW 9 82,790,922 (GRCm39) missense probably benign 0.01
R4895:Phip UTSW 9 82,841,648 (GRCm39) missense probably benign 0.20
R5001:Phip UTSW 9 82,778,072 (GRCm39) splice site probably null
R5094:Phip UTSW 9 82,753,897 (GRCm39) missense probably benign
R5181:Phip UTSW 9 82,753,243 (GRCm39) utr 3 prime probably benign
R5194:Phip UTSW 9 82,790,915 (GRCm39) missense probably benign 0.03
R5291:Phip UTSW 9 82,827,936 (GRCm39) missense probably damaging 1.00
R5335:Phip UTSW 9 82,782,809 (GRCm39) missense possibly damaging 0.93
R5458:Phip UTSW 9 82,808,553 (GRCm39) missense probably benign 0.40
R5704:Phip UTSW 9 82,753,408 (GRCm39) missense probably damaging 0.97
R5866:Phip UTSW 9 82,772,203 (GRCm39) missense probably benign
R5870:Phip UTSW 9 82,790,730 (GRCm39) splice site probably benign
R5890:Phip UTSW 9 82,789,005 (GRCm39) missense probably benign 0.00
R6232:Phip UTSW 9 82,785,234 (GRCm39) missense probably benign
R6379:Phip UTSW 9 82,795,910 (GRCm39) missense probably damaging 0.98
R6653:Phip UTSW 9 82,782,794 (GRCm39) nonsense probably null
R7129:Phip UTSW 9 82,759,353 (GRCm39) missense probably damaging 0.98
R7290:Phip UTSW 9 82,753,346 (GRCm39) missense possibly damaging 0.94
R7598:Phip UTSW 9 82,787,711 (GRCm39) missense possibly damaging 0.94
R7632:Phip UTSW 9 82,785,243 (GRCm39) missense probably benign
R7752:Phip UTSW 9 82,772,203 (GRCm39) missense probably benign
R7827:Phip UTSW 9 82,790,886 (GRCm39) missense probably benign
R7901:Phip UTSW 9 82,772,203 (GRCm39) missense probably benign
R7960:Phip UTSW 9 82,775,401 (GRCm39) missense probably benign 0.00
R8006:Phip UTSW 9 82,772,179 (GRCm39) missense possibly damaging 0.93
R8066:Phip UTSW 9 82,757,351 (GRCm39) missense probably benign 0.05
R8080:Phip UTSW 9 82,769,662 (GRCm39) missense probably damaging 1.00
R8135:Phip UTSW 9 82,812,427 (GRCm39) missense probably benign 0.09
R8347:Phip UTSW 9 82,790,816 (GRCm39) missense probably benign 0.02
R8459:Phip UTSW 9 82,758,106 (GRCm39) missense probably benign
R8705:Phip UTSW 9 82,775,612 (GRCm39) missense probably damaging 0.99
R8706:Phip UTSW 9 82,787,765 (GRCm39) missense possibly damaging 0.89
R8743:Phip UTSW 9 82,809,140 (GRCm39) missense probably benign 0.18
R8801:Phip UTSW 9 82,758,305 (GRCm39) missense probably benign 0.22
R8930:Phip UTSW 9 82,789,041 (GRCm39) missense possibly damaging 0.67
R8932:Phip UTSW 9 82,789,041 (GRCm39) missense possibly damaging 0.67
R8969:Phip UTSW 9 82,809,017 (GRCm39) intron probably benign
R9064:Phip UTSW 9 82,753,540 (GRCm39) missense probably benign 0.20
R9332:Phip UTSW 9 82,757,412 (GRCm39) missense probably damaging 0.98
R9335:Phip UTSW 9 82,814,979 (GRCm39) missense probably benign 0.03
R9520:Phip UTSW 9 82,753,437 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTTTTAAGATAGGACTCCTTGAGCTG -3'
(R):5'- TCTCTGGGTGGGAGGAGAAATC -3'

Sequencing Primer
(F):5'- GAGTGCACGTGCTTATCAAATCC -3'
(R):5'- TGCACAAATTTTACTGTACTCTGC -3'
Posted On 2014-09-18