Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Map7'

230320

Institutional Source

Beutler Lab

Gene Symbol

Map7

Ensembl Gene

ENSMUSG00000019996

Gene Name

microtubule-associated protein 7

Synonyms

E-MAP-115, mste, ste, Mtap7, mshi

MMRRC Submission

040101-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20148471-20281590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20246616 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 143 (V143F)

Ref Sequence

ENSEMBL: ENSMUSP00000111963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020173] [ENSMUST00000116259] [ENSMUST00000213312] [ENSMUST00000215924]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000020173
AA Change: V143F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020173
Gene: ENSMUSG00000019996
AA Change: V143F

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
low complexity region	55	85	N/A	INTRINSIC
coiled coil region	89	152	N/A	INTRINSIC
low complexity region	365	375	N/A	INTRINSIC
low complexity region	379	392	N/A	INTRINSIC
Pfam:MAP7	447	616	1.1e-59	PFAM
internal_repeat_1	623	658	5.23e-6	PROSPERO
internal_repeat_1	699	736	5.23e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000116259
AA Change: V143F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111963
Gene: ENSMUSG00000019996
AA Change: V143F

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
low complexity region	55	85	N/A	INTRINSIC
coiled coil region	89	152	N/A	INTRINSIC
low complexity region	365	375	N/A	INTRINSIC
low complexity region	379	392	N/A	INTRINSIC
Pfam:MAP7	453	611	4.7e-46	PFAM
internal_repeat_1	623	656	2.41e-5	PROSPERO
internal_repeat_1	699	734	2.41e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000213312
AA Change: V152F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214823

Predicted Effect

probably benign
Transcript: ENSMUST00000215924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216065

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Males homozygous for mutations in this marker are sterile with small, disorganized testes, small epidiymis and seminiferous tubules. They have deformed spermatid nuclei and a block in spermatogenesis. Aberrant microtubules are seen in elongating spermatids and sertoli cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Map7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01456:Map7	APN	10	20273804	missense	unknown
IGL03019:Map7	APN	10	20267355	missense	unknown
IGL03263:Map7	APN	10	20245322	nonsense	probably null
R0893:Map7	UTSW	10	20273883	splice site	probably null
R1172:Map7	UTSW	10	20245299	missense	probably damaging	1.00
R2239:Map7	UTSW	10	20278282	missense	unknown
R3760:Map7	UTSW	10	20276281	splice site	probably benign
R3980:Map7	UTSW	10	20267353	missense	unknown
R5009:Map7	UTSW	10	20261918	nonsense	probably null
R5397:Map7	UTSW	10	20273321	missense	unknown
R5422:Map7	UTSW	10	20266766	missense	probably damaging	0.99
R5501:Map7	UTSW	10	20276202	missense	unknown
R5664:Map7	UTSW	10	20267359	missense	unknown
R5773:Map7	UTSW	10	20246644	missense	probably benign	0.22
R6209:Map7	UTSW	10	20276280	splice site	probably null
R6438:Map7	UTSW	10	20267257	missense	unknown
R6446:Map7	UTSW	10	20278233	missense	unknown
R6919:Map7	UTSW	10	20171082	start gained	probably benign
R7327:Map7	UTSW	10	20233462	missense	unknown
R7440:Map7	UTSW	10	20261859	missense	probably damaging	1.00
R7596:Map7	UTSW	10	20278181	missense	unknown
R7958:Map7	UTSW	10	20229829	missense	unknown
R8517:Map7	UTSW	10	20261835	missense	probably damaging	0.96
R8524:Map7	UTSW	10	20266823	missense	probably benign	0.27
R8977:Map7	UTSW	10	20269590	critical splice donor site	probably null
R9164:Map7	UTSW	10	20246664	missense	probably benign	0.39
R9453:Map7	UTSW	10	20278235	missense	unknown
R9522:Map7	UTSW	10	20229896	missense	possibly damaging	0.81
R9574:Map7	UTSW	10	20278220	missense	unknown
X0022:Map7	UTSW	10	20269582	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CACAAGGACTTCTGAACTGGG -3'
(R):5'- ACCAAATGCACTCTTACTGTCCAG -3'

Sequencing Primer
(F):5'- ACTTCTGAACTGGGAACTGATG -3'
(R):5'- TGCACTCTTACTGTCCAGCAAAAAC -3'

Posted On

2014-09-18