Incidental Mutation 'R2097:Map7'
ID230320
Institutional Source Beutler Lab
Gene Symbol Map7
Ensembl Gene ENSMUSG00000019996
Gene Namemicrotubule-associated protein 7
SynonymsE-MAP-115, mste, ste, Mtap7, mshi
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2097 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location20148471-20281590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20246616 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 143 (V143F)
Ref Sequence ENSEMBL: ENSMUSP00000111963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020173] [ENSMUST00000116259] [ENSMUST00000213312] [ENSMUST00000215924]
Predicted Effect probably damaging
Transcript: ENSMUST00000020173
AA Change: V143F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020173
Gene: ENSMUSG00000019996
AA Change: V143F

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 447 616 1.1e-59 PFAM
internal_repeat_1 623 658 5.23e-6 PROSPERO
internal_repeat_1 699 736 5.23e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000116259
AA Change: V143F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111963
Gene: ENSMUSG00000019996
AA Change: V143F

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 453 611 4.7e-46 PFAM
internal_repeat_1 623 656 2.41e-5 PROSPERO
internal_repeat_1 699 734 2.41e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000213312
AA Change: V152F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214823
Predicted Effect probably benign
Transcript: ENSMUST00000215924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216065
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Males homozygous for mutations in this marker are sterile with small, disorganized testes, small epidiymis and seminiferous tubules. They have deformed spermatid nuclei and a block in spermatogenesis. Aberrant microtubules are seen in elongating spermatids and sertoli cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Map7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Map7 APN 10 20273804 missense unknown
IGL03019:Map7 APN 10 20267355 missense unknown
IGL03263:Map7 APN 10 20245322 nonsense probably null
R0893:Map7 UTSW 10 20273883 splice site probably null
R1172:Map7 UTSW 10 20245299 missense probably damaging 1.00
R2239:Map7 UTSW 10 20278282 missense unknown
R3760:Map7 UTSW 10 20276281 splice site probably benign
R3980:Map7 UTSW 10 20267353 missense unknown
R5009:Map7 UTSW 10 20261918 nonsense probably null
R5397:Map7 UTSW 10 20273321 missense unknown
R5422:Map7 UTSW 10 20266766 missense probably damaging 0.99
R5501:Map7 UTSW 10 20276202 missense unknown
R5664:Map7 UTSW 10 20267359 missense unknown
R5773:Map7 UTSW 10 20246644 missense probably benign 0.22
R6209:Map7 UTSW 10 20276280 splice site probably null
R6438:Map7 UTSW 10 20267257 missense unknown
R6446:Map7 UTSW 10 20278233 missense unknown
R6919:Map7 UTSW 10 20171082 start gained probably benign
R7327:Map7 UTSW 10 20233462 missense unknown
R7440:Map7 UTSW 10 20261859 missense probably damaging 1.00
R7596:Map7 UTSW 10 20278181 missense unknown
X0022:Map7 UTSW 10 20269582 missense unknown
Predicted Primers PCR Primer
(F):5'- CACAAGGACTTCTGAACTGGG -3'
(R):5'- ACCAAATGCACTCTTACTGTCCAG -3'

Sequencing Primer
(F):5'- ACTTCTGAACTGGGAACTGATG -3'
(R):5'- TGCACTCTTACTGTCCAGCAAAAAC -3'
Posted On2014-09-18