Incidental Mutation 'R2097:Mcm3ap'
ID 230322
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Name minichromosome maintenance complex component 3 associated protein
Synonyms GANP
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 76304761-76351691 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76348323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1893 (L1893P)
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170795]
AlphaFold Q9WUU9
Predicted Effect probably damaging
Transcript: ENSMUST00000170795
AA Change: L1893P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: L1893P

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218361
AA Change: L37P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218904
Meta Mutation Damage Score 0.5092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76,307,011 (GRCm39) missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76,328,769 (GRCm39) missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76,306,159 (GRCm39) missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76,335,400 (GRCm39) missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76,306,639 (GRCm39) missense probably benign
IGL01882:Mcm3ap APN 10 76,319,018 (GRCm39) missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76,306,951 (GRCm39) missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76,305,899 (GRCm39) missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76,320,572 (GRCm39) missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76,332,386 (GRCm39) nonsense probably null
IGL02487:Mcm3ap APN 10 76,343,389 (GRCm39) unclassified probably benign
IGL02488:Mcm3ap APN 10 76,335,483 (GRCm39) missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76,342,255 (GRCm39) missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76,346,867 (GRCm39) missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76,337,082 (GRCm39) missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76,313,601 (GRCm39) missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76,307,092 (GRCm39) splice site probably benign
IGL02955:Mcm3ap APN 10 76,343,300 (GRCm39) missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76,306,894 (GRCm39) missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76,340,531 (GRCm39) missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76,306,150 (GRCm39) missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76,318,567 (GRCm39) missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76,320,483 (GRCm39) splice site probably benign
Bane UTSW 10 76,319,060 (GRCm39) missense probably damaging 1.00
Doom UTSW 10 76,337,148 (GRCm39) missense probably benign
woeful UTSW 10 76,316,849 (GRCm39) missense probably benign 0.44
PIT4377001:Mcm3ap UTSW 10 76,338,596 (GRCm39) missense possibly damaging 0.78
PIT4791001:Mcm3ap UTSW 10 76,342,307 (GRCm39) missense probably damaging 1.00
R0105:Mcm3ap UTSW 10 76,335,368 (GRCm39) missense probably damaging 1.00
R0144:Mcm3ap UTSW 10 76,316,849 (GRCm39) missense probably benign 0.44
R0423:Mcm3ap UTSW 10 76,338,539 (GRCm39) missense probably benign 0.00
R0692:Mcm3ap UTSW 10 76,319,003 (GRCm39) missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76,313,748 (GRCm39) unclassified probably benign
R1441:Mcm3ap UTSW 10 76,307,000 (GRCm39) missense probably benign
R1512:Mcm3ap UTSW 10 76,306,347 (GRCm39) missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76,340,121 (GRCm39) missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76,319,022 (GRCm39) missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76,332,375 (GRCm39) missense probably benign 0.36
R1597:Mcm3ap UTSW 10 76,319,060 (GRCm39) missense probably damaging 1.00
R1743:Mcm3ap UTSW 10 76,320,508 (GRCm39) missense possibly damaging 0.53
R1773:Mcm3ap UTSW 10 76,306,994 (GRCm39) missense probably benign
R1922:Mcm3ap UTSW 10 76,343,195 (GRCm39) missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76,305,902 (GRCm39) missense probably benign 0.43
R2436:Mcm3ap UTSW 10 76,325,891 (GRCm39) missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76,325,260 (GRCm39) missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76,318,513 (GRCm39) missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76,342,280 (GRCm39) missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76,343,171 (GRCm39) missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76,306,404 (GRCm39) missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76,324,300 (GRCm39) missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76,320,495 (GRCm39) nonsense probably null
R4907:Mcm3ap UTSW 10 76,329,275 (GRCm39) missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76,338,536 (GRCm39) missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76,343,373 (GRCm39) missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76,306,760 (GRCm39) missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76,319,148 (GRCm39) missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76,332,316 (GRCm39) nonsense probably null
R5473:Mcm3ap UTSW 10 76,338,593 (GRCm39) missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76,316,930 (GRCm39) missense possibly damaging 0.89
R5931:Mcm3ap UTSW 10 76,307,000 (GRCm39) missense probably benign
R5939:Mcm3ap UTSW 10 76,344,195 (GRCm39) missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76,324,253 (GRCm39) missense possibly damaging 0.46
R5998:Mcm3ap UTSW 10 76,316,976 (GRCm39) critical splice donor site probably null
R6122:Mcm3ap UTSW 10 76,342,441 (GRCm39) missense probably damaging 1.00
R6192:Mcm3ap UTSW 10 76,336,934 (GRCm39) missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76,351,540 (GRCm39) missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76,307,312 (GRCm39) nonsense probably null
R6669:Mcm3ap UTSW 10 76,343,171 (GRCm39) missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76,325,366 (GRCm39) missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76,337,148 (GRCm39) missense probably benign
R6864:Mcm3ap UTSW 10 76,343,313 (GRCm39) missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76,306,049 (GRCm39) missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76,340,087 (GRCm39) missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76,351,500 (GRCm39) missense probably benign 0.09
R7212:Mcm3ap UTSW 10 76,337,145 (GRCm39) missense probably benign 0.01
R7403:Mcm3ap UTSW 10 76,318,657 (GRCm39) critical splice donor site probably null
R7470:Mcm3ap UTSW 10 76,344,231 (GRCm39) missense probably damaging 1.00
R7561:Mcm3ap UTSW 10 76,328,712 (GRCm39) missense possibly damaging 0.94
R7610:Mcm3ap UTSW 10 76,332,554 (GRCm39) splice site probably null
R7620:Mcm3ap UTSW 10 76,306,267 (GRCm39) missense probably benign 0.00
R7898:Mcm3ap UTSW 10 76,342,441 (GRCm39) missense probably damaging 1.00
R8266:Mcm3ap UTSW 10 76,312,414 (GRCm39) nonsense probably null
R8355:Mcm3ap UTSW 10 76,329,335 (GRCm39) missense probably benign 0.32
R8367:Mcm3ap UTSW 10 76,313,693 (GRCm39) missense possibly damaging 0.65
R8867:Mcm3ap UTSW 10 76,306,538 (GRCm39) missense probably benign 0.31
R9282:Mcm3ap UTSW 10 76,342,352 (GRCm39) missense probably damaging 1.00
R9319:Mcm3ap UTSW 10 76,318,638 (GRCm39) missense probably damaging 1.00
R9339:Mcm3ap UTSW 10 76,306,358 (GRCm39) missense probably benign 0.04
R9554:Mcm3ap UTSW 10 76,332,310 (GRCm39) missense probably damaging 0.97
R9706:Mcm3ap UTSW 10 76,312,352 (GRCm39) missense probably damaging 1.00
X0026:Mcm3ap UTSW 10 76,318,619 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTCTGACGTCATGTGGGC -3'
(R):5'- TTCCTGTGTAGCCTGTAGACTAGG -3'

Sequencing Primer
(F):5'- GGCATCCACATCTGTTCACGG -3'
(R):5'- TGTAGACTAGGCTGCCTCACAC -3'
Posted On 2014-09-18