Incidental Mutation 'R2097:Pwp2'
ID 230323
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene Name PWP2 periodic tryptophan protein homolog (yeast)
Synonyms Pwp2, Pwp2h, 6530411D08Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.780) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 78006743-78020983 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 78013576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042556]
AlphaFold Q8BU03
Predicted Effect probably benign
Transcript: ENSMUST00000042556
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78,014,841 (GRCm39) missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78,014,119 (GRCm39) missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78,019,934 (GRCm39) missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78,014,899 (GRCm39) missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78,014,899 (GRCm39) missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78,016,917 (GRCm39) missense probably benign
IGL02612:Pwp2 APN 10 78,018,828 (GRCm39) missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78,020,921 (GRCm39) start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78,014,304 (GRCm39) missense probably benign 0.38
R0573:Pwp2 UTSW 10 78,018,520 (GRCm39) missense probably benign 0.37
R1835:Pwp2 UTSW 10 78,014,925 (GRCm39) missense probably damaging 1.00
R2251:Pwp2 UTSW 10 78,016,922 (GRCm39) missense probably benign 0.04
R2967:Pwp2 UTSW 10 78,018,532 (GRCm39) missense possibly damaging 0.94
R4909:Pwp2 UTSW 10 78,018,328 (GRCm39) missense possibly damaging 0.51
R4950:Pwp2 UTSW 10 78,018,840 (GRCm39) missense probably benign 0.00
R4970:Pwp2 UTSW 10 78,009,527 (GRCm39) missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78,018,527 (GRCm39) missense probably benign 0.23
R5355:Pwp2 UTSW 10 78,011,378 (GRCm39) missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78,013,605 (GRCm39) missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78,018,835 (GRCm39) missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78,007,952 (GRCm39) missense probably benign 0.00
R5928:Pwp2 UTSW 10 78,018,290 (GRCm39) missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78,012,961 (GRCm39) missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78,018,222 (GRCm39) splice site probably null
R6848:Pwp2 UTSW 10 78,020,127 (GRCm39) splice site probably null
R6897:Pwp2 UTSW 10 78,007,917 (GRCm39) missense probably damaging 1.00
R7060:Pwp2 UTSW 10 78,009,084 (GRCm39) splice site probably null
R7269:Pwp2 UTSW 10 78,012,170 (GRCm39) missense probably benign 0.30
R7367:Pwp2 UTSW 10 78,018,314 (GRCm39) missense probably damaging 1.00
R7368:Pwp2 UTSW 10 78,018,314 (GRCm39) missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78,018,314 (GRCm39) missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78,014,395 (GRCm39) missense probably benign 0.00
R7838:Pwp2 UTSW 10 78,018,778 (GRCm39) critical splice donor site probably null
R7898:Pwp2 UTSW 10 78,009,240 (GRCm39) missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78,007,930 (GRCm39) missense possibly damaging 0.82
R8447:Pwp2 UTSW 10 78,007,873 (GRCm39) missense probably benign 0.10
R8750:Pwp2 UTSW 10 78,013,659 (GRCm39) missense probably damaging 1.00
R9302:Pwp2 UTSW 10 78,009,540 (GRCm39) missense probably benign 0.04
R9367:Pwp2 UTSW 10 78,014,827 (GRCm39) nonsense probably null
Z1177:Pwp2 UTSW 10 78,007,808 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGGGACTCAATGACCAG -3'
(R):5'- ACATTAGTGCTCCAGCCATTCC -3'

Sequencing Primer
(F):5'- AGGGGACTCAATGACCAGTTCTC -3'
(R):5'- CCAGCCATTCCCACATCTG -3'
Posted On 2014-09-18