Incidental Mutation 'R2097:Ptprq'
ID 230324
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Name protein tyrosine phosphatase receptor type Q
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.236) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 107352910-107555912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107489354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 924 (T924A)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
AlphaFold P0C5E4
Predicted Effect probably benign
Transcript: ENSMUST00000050702
AA Change: T924A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: T924A

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107,412,790 (GRCm39) missense probably damaging 0.98
IGL00537:Ptprq APN 10 107,546,383 (GRCm39) missense probably benign 0.07
IGL00547:Ptprq APN 10 107,554,402 (GRCm39) missense probably damaging 0.99
IGL00586:Ptprq APN 10 107,443,983 (GRCm39) splice site probably benign
IGL00648:Ptprq APN 10 107,482,577 (GRCm39) missense probably benign 0.10
IGL01123:Ptprq APN 10 107,522,079 (GRCm39) missense probably damaging 0.96
IGL01343:Ptprq APN 10 107,474,700 (GRCm39) missense probably damaging 0.96
IGL01348:Ptprq APN 10 107,547,765 (GRCm39) missense probably damaging 1.00
IGL01433:Ptprq APN 10 107,412,741 (GRCm39) missense probably damaging 0.99
IGL01510:Ptprq APN 10 107,547,909 (GRCm39) missense probably damaging 1.00
IGL01535:Ptprq APN 10 107,535,457 (GRCm39) missense probably benign
IGL01631:Ptprq APN 10 107,479,399 (GRCm39) missense probably benign 0.00
IGL01633:Ptprq APN 10 107,535,584 (GRCm39) splice site probably benign
IGL01702:Ptprq APN 10 107,353,727 (GRCm39) missense probably benign 0.00
IGL01733:Ptprq APN 10 107,498,460 (GRCm39) missense probably benign 0.10
IGL01806:Ptprq APN 10 107,535,469 (GRCm39) missense probably damaging 1.00
IGL01832:Ptprq APN 10 107,401,700 (GRCm39) critical splice donor site probably null
IGL01961:Ptprq APN 10 107,479,515 (GRCm39) missense probably damaging 1.00
IGL02108:Ptprq APN 10 107,482,478 (GRCm39) missense probably damaging 1.00
IGL02120:Ptprq APN 10 107,503,333 (GRCm39) missense probably damaging 1.00
IGL02160:Ptprq APN 10 107,489,426 (GRCm39) missense probably benign 0.00
IGL02178:Ptprq APN 10 107,522,180 (GRCm39) missense probably benign 0.03
IGL02249:Ptprq APN 10 107,418,220 (GRCm39) missense probably damaging 1.00
IGL02267:Ptprq APN 10 107,482,419 (GRCm39) missense probably damaging 1.00
IGL02527:Ptprq APN 10 107,522,424 (GRCm39) missense probably benign 0.04
IGL02529:Ptprq APN 10 107,471,226 (GRCm39) missense probably benign 0.03
IGL02542:Ptprq APN 10 107,498,416 (GRCm39) missense probably damaging 1.00
IGL02582:Ptprq APN 10 107,479,860 (GRCm39) missense probably benign 0.00
IGL02708:Ptprq APN 10 107,488,561 (GRCm39) missense probably damaging 1.00
IGL02894:Ptprq APN 10 107,503,285 (GRCm39) missense probably benign
IGL02903:Ptprq APN 10 107,502,447 (GRCm39) missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107,503,321 (GRCm39) missense probably benign 0.03
IGL02982:Ptprq APN 10 107,422,545 (GRCm39) missense probably damaging 1.00
IGL03000:Ptprq APN 10 107,378,518 (GRCm39) missense probably damaging 1.00
IGL03024:Ptprq APN 10 107,521,427 (GRCm39) missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107,524,368 (GRCm39) missense probably benign
P0043:Ptprq UTSW 10 107,416,086 (GRCm39) missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107,502,428 (GRCm39) missense probably damaging 1.00
R0200:Ptprq UTSW 10 107,521,018 (GRCm39) missense probably benign
R0268:Ptprq UTSW 10 107,541,409 (GRCm39) missense probably benign
R0276:Ptprq UTSW 10 107,378,596 (GRCm39) critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107,444,278 (GRCm39) missense probably damaging 0.96
R0335:Ptprq UTSW 10 107,544,589 (GRCm39) missense probably benign
R0344:Ptprq UTSW 10 107,541,443 (GRCm39) missense probably benign
R0357:Ptprq UTSW 10 107,522,060 (GRCm39) splice site probably benign
R0454:Ptprq UTSW 10 107,418,391 (GRCm39) nonsense probably null
R0479:Ptprq UTSW 10 107,479,855 (GRCm39) nonsense probably null
R0491:Ptprq UTSW 10 107,444,036 (GRCm39) missense probably damaging 0.98
R0519:Ptprq UTSW 10 107,374,781 (GRCm39) splice site probably benign
R0523:Ptprq UTSW 10 107,416,081 (GRCm39) missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107,546,488 (GRCm39) missense probably benign 0.33
R0746:Ptprq UTSW 10 107,353,692 (GRCm39) missense probably damaging 1.00
R0755:Ptprq UTSW 10 107,418,400 (GRCm39) missense probably benign 0.09
R1434:Ptprq UTSW 10 107,422,575 (GRCm39) missense probably damaging 1.00
R1445:Ptprq UTSW 10 107,498,423 (GRCm39) missense probably damaging 1.00
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1558:Ptprq UTSW 10 107,479,904 (GRCm39) missense probably damaging 1.00
R1567:Ptprq UTSW 10 107,401,748 (GRCm39) missense probably benign 0.13
R1711:Ptprq UTSW 10 107,370,560 (GRCm39) nonsense probably null
R1720:Ptprq UTSW 10 107,522,155 (GRCm39) missense probably damaging 1.00
R1746:Ptprq UTSW 10 107,474,691 (GRCm39) missense probably damaging 1.00
R1776:Ptprq UTSW 10 107,520,950 (GRCm39) missense probably damaging 1.00
R1822:Ptprq UTSW 10 107,554,339 (GRCm39) missense probably damaging 1.00
R1872:Ptprq UTSW 10 107,479,860 (GRCm39) missense probably benign 0.19
R1944:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R1945:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R2006:Ptprq UTSW 10 107,502,407 (GRCm39) missense probably damaging 1.00
R2014:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2015:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2172:Ptprq UTSW 10 107,426,855 (GRCm39) nonsense probably null
R2174:Ptprq UTSW 10 107,541,414 (GRCm39) missense probably damaging 1.00
R2248:Ptprq UTSW 10 107,478,931 (GRCm39) splice site probably null
R2404:Ptprq UTSW 10 107,522,460 (GRCm39) missense probably damaging 1.00
R3423:Ptprq UTSW 10 107,418,337 (GRCm39) missense probably damaging 0.99
R3683:Ptprq UTSW 10 107,544,489 (GRCm39) missense probably benign 0.01
R3875:Ptprq UTSW 10 107,520,965 (GRCm39) missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3946:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3974:Ptprq UTSW 10 107,547,923 (GRCm39) missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107,379,257 (GRCm39) missense probably damaging 0.99
R4105:Ptprq UTSW 10 107,408,828 (GRCm39) missense probably damaging 1.00
R4118:Ptprq UTSW 10 107,547,781 (GRCm39) missense probably benign 0.37
R4175:Ptprq UTSW 10 107,547,778 (GRCm39) missense probably benign
R4231:Ptprq UTSW 10 107,522,144 (GRCm39) nonsense probably null
R4356:Ptprq UTSW 10 107,444,225 (GRCm39) missense probably damaging 0.99
R4435:Ptprq UTSW 10 107,520,916 (GRCm39) missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4679:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4745:Ptprq UTSW 10 107,360,114 (GRCm39) missense probably damaging 1.00
R4771:Ptprq UTSW 10 107,524,288 (GRCm39) missense probably benign
R4778:Ptprq UTSW 10 107,426,883 (GRCm39) missense probably benign 0.15
R4808:Ptprq UTSW 10 107,554,368 (GRCm39) missense probably damaging 1.00
R4809:Ptprq UTSW 10 107,399,036 (GRCm39) missense probably damaging 1.00
R4818:Ptprq UTSW 10 107,546,442 (GRCm39) missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107,489,393 (GRCm39) missense probably benign 0.00
R4901:Ptprq UTSW 10 107,524,275 (GRCm39) missense probably benign 0.01
R4942:Ptprq UTSW 10 107,524,290 (GRCm39) missense probably benign 0.01
R4946:Ptprq UTSW 10 107,361,595 (GRCm39) missense probably benign
R4959:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R4973:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R5007:Ptprq UTSW 10 107,444,137 (GRCm39) missense probably benign 0.00
R5053:Ptprq UTSW 10 107,399,063 (GRCm39) missense probably damaging 1.00
R5055:Ptprq UTSW 10 107,370,540 (GRCm39) missense probably benign 0.37
R5090:Ptprq UTSW 10 107,361,950 (GRCm39) missense probably damaging 1.00
R5158:Ptprq UTSW 10 107,370,565 (GRCm39) missense probably damaging 1.00
R5163:Ptprq UTSW 10 107,360,192 (GRCm39) missense probably damaging 1.00
R5222:Ptprq UTSW 10 107,498,425 (GRCm39) missense probably damaging 0.96
R5244:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107,535,496 (GRCm39) missense probably damaging 0.99
R5503:Ptprq UTSW 10 107,524,189 (GRCm39) splice site probably null
R5508:Ptprq UTSW 10 107,522,092 (GRCm39) missense probably benign 0.00
R5601:Ptprq UTSW 10 107,444,291 (GRCm39) missense probably benign
R5722:Ptprq UTSW 10 107,522,226 (GRCm39) missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107,555,744 (GRCm39) start gained probably benign
R5862:Ptprq UTSW 10 107,401,739 (GRCm39) missense probably benign 0.02
R5891:Ptprq UTSW 10 107,412,756 (GRCm39) missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107,359,374 (GRCm39) missense probably damaging 1.00
R6054:Ptprq UTSW 10 107,418,219 (GRCm39) missense probably damaging 1.00
R6058:Ptprq UTSW 10 107,471,135 (GRCm39) missense probably benign 0.00
R6075:Ptprq UTSW 10 107,361,621 (GRCm39) missense probably damaging 1.00
R6101:Ptprq UTSW 10 107,416,127 (GRCm39) missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107,353,748 (GRCm39) missense probably damaging 1.00
R6235:Ptprq UTSW 10 107,471,199 (GRCm39) missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107,544,529 (GRCm39) missense probably damaging 0.99
R6394:Ptprq UTSW 10 107,478,804 (GRCm39) nonsense probably null
R6449:Ptprq UTSW 10 107,541,444 (GRCm39) missense probably benign 0.00
R6526:Ptprq UTSW 10 107,378,514 (GRCm39) nonsense probably null
R6544:Ptprq UTSW 10 107,444,102 (GRCm39) missense probably damaging 1.00
R6609:Ptprq UTSW 10 107,408,829 (GRCm39) missense probably damaging 0.99
R6862:Ptprq UTSW 10 107,522,086 (GRCm39) missense probably damaging 0.96
R6874:Ptprq UTSW 10 107,554,460 (GRCm39) missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107,411,865 (GRCm39) missense probably benign 0.00
R7082:Ptprq UTSW 10 107,544,591 (GRCm39) missense probably benign 0.10
R7210:Ptprq UTSW 10 107,521,032 (GRCm39) missense probably damaging 1.00
R7253:Ptprq UTSW 10 107,444,134 (GRCm39) missense probably benign 0.30
R7293:Ptprq UTSW 10 107,471,367 (GRCm39) nonsense probably null
R7445:Ptprq UTSW 10 107,426,820 (GRCm39) missense probably damaging 1.00
R7632:Ptprq UTSW 10 107,547,783 (GRCm39) missense probably benign 0.32
R7685:Ptprq UTSW 10 107,479,839 (GRCm39) missense probably damaging 1.00
R7703:Ptprq UTSW 10 107,480,007 (GRCm39) missense probably benign 0.01
R7774:Ptprq UTSW 10 107,479,530 (GRCm39) missense probably damaging 0.96
R7897:Ptprq UTSW 10 107,546,484 (GRCm39) missense probably benign 0.21
R7936:Ptprq UTSW 10 107,488,572 (GRCm39) missense probably damaging 1.00
R7983:Ptprq UTSW 10 107,444,272 (GRCm39) nonsense probably null
R8023:Ptprq UTSW 10 107,488,477 (GRCm39) nonsense probably null
R8071:Ptprq UTSW 10 107,479,896 (GRCm39) missense possibly damaging 0.62
R8084:Ptprq UTSW 10 107,444,294 (GRCm39) missense probably benign
R8086:Ptprq UTSW 10 107,482,500 (GRCm39) nonsense probably null
R8169:Ptprq UTSW 10 107,418,351 (GRCm39) missense probably damaging 1.00
R8223:Ptprq UTSW 10 107,535,499 (GRCm39) missense probably benign 0.00
R8235:Ptprq UTSW 10 107,541,351 (GRCm39) missense probably benign 0.32
R8235:Ptprq UTSW 10 107,418,402 (GRCm39) missense probably damaging 1.00
R8278:Ptprq UTSW 10 107,522,239 (GRCm39) missense possibly damaging 0.87
R8710:Ptprq UTSW 10 107,411,919 (GRCm39) missense possibly damaging 0.67
R8828:Ptprq UTSW 10 107,482,513 (GRCm39) missense probably benign
R8830:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R8869:Ptprq UTSW 10 107,535,469 (GRCm39) missense probably damaging 1.00
R9012:Ptprq UTSW 10 107,489,411 (GRCm39) missense probably benign 0.09
R9072:Ptprq UTSW 10 107,401,736 (GRCm39) missense
R9153:Ptprq UTSW 10 107,416,126 (GRCm39) missense probably damaging 0.98
R9202:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R9252:Ptprq UTSW 10 107,522,247 (GRCm39) missense probably benign 0.12
R9306:Ptprq UTSW 10 107,422,599 (GRCm39) missense probably benign 0.00
R9492:Ptprq UTSW 10 107,478,813 (GRCm39) missense probably damaging 1.00
R9519:Ptprq UTSW 10 107,520,961 (GRCm39) missense probably damaging 1.00
R9581:Ptprq UTSW 10 107,547,771 (GRCm39) missense possibly damaging 0.53
R9593:Ptprq UTSW 10 107,524,254 (GRCm39) missense possibly damaging 0.92
R9621:Ptprq UTSW 10 107,378,523 (GRCm39) missense probably damaging 1.00
R9732:Ptprq UTSW 10 107,412,767 (GRCm39) missense probably damaging 1.00
R9743:Ptprq UTSW 10 107,520,982 (GRCm39) missense probably damaging 1.00
R9771:Ptprq UTSW 10 107,521,085 (GRCm39) missense probably damaging 0.99
R9788:Ptprq UTSW 10 107,401,751 (GRCm39) missense probably benign 0.24
Z1088:Ptprq UTSW 10 107,535,533 (GRCm39) missense possibly damaging 0.56
Z1176:Ptprq UTSW 10 107,361,931 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGCATCCAGCTAACGGTG -3'
(R):5'- GGCATCTTTATGAAGTTAAGCCAAG -3'

Sequencing Primer
(F):5'- GGTGGGTTTTAGGCTTAATAACACAC -3'
(R):5'- GCCAAGAAATTGCTGTATTTTTGCTG -3'
Posted On 2014-09-18