Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Ttc25'

230325

Institutional Source

Beutler Lab

Gene Symbol

Ttc25

Ensembl Gene

ENSMUSG00000006784

Gene Name

tetratricopeptide repeat domain 25

Synonyms

MMRRC Submission

040101-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100545607-100572568 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100563582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 398 (F398I)

Ref Sequence

ENSEMBL: ENSMUSP00000006976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006976] [ENSMUST00000092684]

AlphaFold

Q9D4B2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006976
AA Change: F398I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006976
Gene: ENSMUSG00000006784
AA Change: F398I

Domain	Start	End	E-Value	Type
TPR	11	44	3.69e1	SMART
TPR	45	78	3.07e1	SMART
TPR	79	112	4.96e0	SMART
low complexity region	147	158	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
TPR	318	351	4.96e0	SMART
TPR	358	391	1.11e1	SMART
Blast:TPR	395	428	7e-14	BLAST
TPR	435	468	2.99e1	SMART
low complexity region	493	505	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092684
AA Change: F398I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000090355
Gene: ENSMUSG00000006784
AA Change: F398I

Domain	Start	End	E-Value	Type
TPR	11	44	3.69e1	SMART
TPR	45	78	3.07e1	SMART
TPR	79	112	4.96e0	SMART
low complexity region	147	158	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
TPR	318	351	4.96e0	SMART
TPR	358	391	1.11e1	SMART
Blast:TPR	395	428	5e-14	BLAST
TPR	435	468	2.99e1	SMART
coiled coil region	528	548	N/A	INTRINSIC
low complexity region	556	567	N/A	INTRINSIC
coiled coil region	599	624	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132143

Meta Mutation Damage Score

0.0905

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display partial preweaning lethality, impaired ciliary motility, and a variety of left-right body symmetry defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Ttc25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02027:Ttc25	APN	11	100569902	missense	probably damaging	1.00
IGL02379:Ttc25	APN	11	100566983	missense	possibly damaging	0.87
IGL03091:Ttc25	APN	11	100550250	nonsense	probably null
IGL02991:Ttc25	UTSW	11	100553872	missense	probably benign	0.01
R0044:Ttc25	UTSW	11	100567001	missense	probably damaging	1.00
R0137:Ttc25	UTSW	11	100563568	missense	probably damaging	1.00
R0280:Ttc25	UTSW	11	100550265	missense	probably damaging	1.00
R1373:Ttc25	UTSW	11	100545832	missense	probably damaging	1.00
R1793:Ttc25	UTSW	11	100569853	splice site	probably null
R2121:Ttc25	UTSW	11	100567011	critical splice donor site	probably null
R2509:Ttc25	UTSW	11	100553535	missense	probably damaging	0.99
R2655:Ttc25	UTSW	11	100553579	missense	probably damaging	1.00
R4635:Ttc25	UTSW	11	100551507	nonsense	probably null
R4773:Ttc25	UTSW	11	100549916	missense	probably benign	0.05
R4858:Ttc25	UTSW	11	100550321	missense	probably damaging	0.96
R5164:Ttc25	UTSW	11	100571520	nonsense	probably null
R5181:Ttc25	UTSW	11	100549893	missense	probably damaging	1.00
R5707:Ttc25	UTSW	11	100554061	missense	probably damaging	0.99
R5742:Ttc25	UTSW	11	100545873	missense	possibly damaging	0.90
R7634:Ttc25	UTSW	11	100561905	critical splice donor site	probably null
R7851:Ttc25	UTSW	11	100545829	missense	probably damaging	1.00
R8186:Ttc25	UTSW	11	100563679	missense	probably benign	0.27
R8194:Ttc25	UTSW	11	100563676	missense	probably benign	0.06
R8444:Ttc25	UTSW	11	100561905	critical splice donor site	probably null
R8879:Ttc25	UTSW	11	100566926	nonsense	probably null
X0018:Ttc25	UTSW	11	100553598	missense	probably damaging	0.99
X0028:Ttc25	UTSW	11	100545898	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGTCTGGCAATATGATGGTAC -3'
(R):5'- AACACAGAGATGCTAGGCTC -3'

Sequencing Primer
(F):5'- ACTTACTAATTATGCTCTGGACCGG -3'
(R):5'- TCAGCCCTTGGGACTGG -3'

Posted On

2014-09-18