Incidental Mutation 'R2097:Trim9'
ID 230327
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Name tripartite motif-containing 9
Synonyms C030048G07Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.406) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 70291307-70394388 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70393933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 4 (M4V)
Ref Sequence ENSEMBL: ENSMUSP00000152887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000167755] [ENSMUST00000221041] [ENSMUST00000221370] [ENSMUST00000222316] [ENSMUST00000223160]
AlphaFold Q8C7M3
Predicted Effect probably benign
Transcript: ENSMUST00000110520
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: M4V

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110522
AA Change: M4V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: M4V

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167755
AA Change: M4V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127081
Gene: ENSMUSG00000021071
AA Change: M4V

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221041
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000221294
Predicted Effect probably benign
Transcript: ENSMUST00000221370
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000222316
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably damaging
Transcript: ENSMUST00000223160
AA Change: M4V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223521
Meta Mutation Damage Score 0.1808 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70,393,887 (GRCm39) missense probably damaging 0.98
IGL01618:Trim9 APN 12 70,295,125 (GRCm39) missense probably benign
IGL01794:Trim9 APN 12 70,328,654 (GRCm39) missense probably damaging 1.00
IGL03101:Trim9 APN 12 70,393,428 (GRCm39) missense probably damaging 1.00
IGL03184:Trim9 APN 12 70,297,995 (GRCm39) missense probably damaging 0.99
E0354:Trim9 UTSW 12 70,319,233 (GRCm39) missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70,327,467 (GRCm39) missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70,393,359 (GRCm39) missense probably damaging 0.99
R0622:Trim9 UTSW 12 70,393,378 (GRCm39) missense probably damaging 1.00
R0941:Trim9 UTSW 12 70,295,037 (GRCm39) missense probably damaging 0.97
R1022:Trim9 UTSW 12 70,298,791 (GRCm39) splice site probably null
R1024:Trim9 UTSW 12 70,298,791 (GRCm39) splice site probably null
R1204:Trim9 UTSW 12 70,393,501 (GRCm39) missense probably damaging 1.00
R1439:Trim9 UTSW 12 70,297,867 (GRCm39) missense probably damaging 1.00
R1530:Trim9 UTSW 12 70,319,202 (GRCm39) missense probably damaging 0.98
R1613:Trim9 UTSW 12 70,295,169 (GRCm39) missense probably damaging 1.00
R1661:Trim9 UTSW 12 70,301,887 (GRCm39) missense probably damaging 0.99
R1665:Trim9 UTSW 12 70,301,887 (GRCm39) missense probably damaging 0.99
R1722:Trim9 UTSW 12 70,295,148 (GRCm39) missense probably benign 0.33
R3082:Trim9 UTSW 12 70,301,887 (GRCm39) missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70,295,167 (GRCm39) missense probably damaging 1.00
R3124:Trim9 UTSW 12 70,295,167 (GRCm39) missense probably damaging 1.00
R3125:Trim9 UTSW 12 70,295,167 (GRCm39) missense probably damaging 1.00
R3738:Trim9 UTSW 12 70,297,969 (GRCm39) missense probably damaging 1.00
R4013:Trim9 UTSW 12 70,393,126 (GRCm39) missense probably damaging 1.00
R4017:Trim9 UTSW 12 70,393,126 (GRCm39) missense probably damaging 1.00
R4560:Trim9 UTSW 12 70,393,892 (GRCm39) nonsense probably null
R4734:Trim9 UTSW 12 70,295,047 (GRCm39) missense probably damaging 1.00
R4748:Trim9 UTSW 12 70,295,047 (GRCm39) missense probably damaging 1.00
R4749:Trim9 UTSW 12 70,295,047 (GRCm39) missense probably damaging 1.00
R4777:Trim9 UTSW 12 70,393,845 (GRCm39) missense probably damaging 1.00
R5027:Trim9 UTSW 12 70,393,482 (GRCm39) missense probably damaging 0.96
R5451:Trim9 UTSW 12 70,393,603 (GRCm39) missense probably benign 0.17
R5471:Trim9 UTSW 12 70,393,566 (GRCm39) missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70,301,987 (GRCm39) missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70,393,413 (GRCm39) missense probably damaging 0.96
R7549:Trim9 UTSW 12 70,393,715 (GRCm39) missense probably damaging 1.00
R7690:Trim9 UTSW 12 70,295,117 (GRCm39) missense probably benign
R7895:Trim9 UTSW 12 70,301,961 (GRCm39) missense probably benign 0.03
R8003:Trim9 UTSW 12 70,393,608 (GRCm39) missense probably benign 0.39
R8026:Trim9 UTSW 12 70,337,161 (GRCm39) missense probably benign 0.00
R8223:Trim9 UTSW 12 70,297,789 (GRCm39) missense probably damaging 0.99
R8956:Trim9 UTSW 12 70,393,665 (GRCm39) missense probably damaging 0.97
R9017:Trim9 UTSW 12 70,314,013 (GRCm39) missense probably benign
R9475:Trim9 UTSW 12 70,393,228 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTCATCTTGTCCAGGTCCAG -3'
(R):5'- TAAGAAAGCAGCTCTCACGG -3'

Sequencing Primer
(F):5'- GTCCAGGTCCAGATAATCATAGTCAG -3'
(R):5'- ACCGTCCGATGAGCCTC -3'
Posted On 2014-09-18