Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Trim9'

230327

Institutional Source

Beutler Lab

Gene Symbol

Trim9

Ensembl Gene

ENSMUSG00000021071

Gene Name

tripartite motif-containing 9

Synonyms

MMRRC Submission

040101-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70244533-70347614 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70347159 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 4 (M4V)

Ref Sequence

ENSEMBL: ENSMUSP00000152887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000167755] [ENSMUST00000221041] [ENSMUST00000221370] [ENSMUST00000222316] [ENSMUST00000223160]

AlphaFold

Q8C7M3

Predicted Effect

probably benign
Transcript: ENSMUST00000110520
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: M4V

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
Pfam:SPRY	598	702	2.4e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110522
AA Change: M4V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: M4V

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
low complexity region	591	605	N/A	INTRINSIC
Pfam:SPRY	674	776	1.5e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167755
AA Change: M4V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000127081
Gene: ENSMUSG00000021071
AA Change: M4V

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221041
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000221294

Predicted Effect

probably benign
Transcript: ENSMUST00000221370
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000222316
AA Change: M4V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223160
AA Change: M4V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223521

Meta Mutation Damage Score

0.1808

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Trim9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00910:Trim9	APN	12	70347113	missense	probably damaging	0.98
IGL01618:Trim9	APN	12	70248351	missense	probably benign
IGL01794:Trim9	APN	12	70281880	missense	probably damaging	1.00
IGL03101:Trim9	APN	12	70346654	missense	probably damaging	1.00
IGL03184:Trim9	APN	12	70251221	missense	probably damaging	0.99
E0354:Trim9	UTSW	12	70272459	missense	probably benign	0.01
IGL03098:Trim9	UTSW	12	70280693	missense	possibly damaging	0.95
R0518:Trim9	UTSW	12	70346585	missense	probably damaging	0.99
R0622:Trim9	UTSW	12	70346604	missense	probably damaging	1.00
R0941:Trim9	UTSW	12	70248263	missense	probably damaging	0.97
R1022:Trim9	UTSW	12	70252017	splice site	probably null
R1024:Trim9	UTSW	12	70252017	splice site	probably null
R1204:Trim9	UTSW	12	70346727	missense	probably damaging	1.00
R1439:Trim9	UTSW	12	70251093	missense	probably damaging	1.00
R1530:Trim9	UTSW	12	70272428	missense	probably damaging	0.98
R1613:Trim9	UTSW	12	70248395	missense	probably damaging	1.00
R1661:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1665:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1722:Trim9	UTSW	12	70248374	missense	probably benign	0.33
R3082:Trim9	UTSW	12	70255113	missense	possibly damaging	0.93
R3123:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3124:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3125:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3738:Trim9	UTSW	12	70251195	missense	probably damaging	1.00
R4013:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4017:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4560:Trim9	UTSW	12	70347118	nonsense	probably null
R4734:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4748:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4749:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4777:Trim9	UTSW	12	70347071	missense	probably damaging	1.00
R5027:Trim9	UTSW	12	70346708	missense	probably damaging	0.96
R5451:Trim9	UTSW	12	70346829	missense	probably benign	0.17
R5471:Trim9	UTSW	12	70346792	missense	possibly damaging	0.93
R6394:Trim9	UTSW	12	70255213	missense	possibly damaging	0.91
R6901:Trim9	UTSW	12	70346639	missense	probably damaging	0.96
R7549:Trim9	UTSW	12	70346941	missense	probably damaging	1.00
R7690:Trim9	UTSW	12	70248343	missense	probably benign
R7895:Trim9	UTSW	12	70255187	missense	probably benign	0.03
R8003:Trim9	UTSW	12	70346834	missense	probably benign	0.39
R8026:Trim9	UTSW	12	70290387	missense	probably benign	0.00
R8223:Trim9	UTSW	12	70251015	missense	probably damaging	0.99
R8956:Trim9	UTSW	12	70346891	missense	probably damaging	0.97
R9017:Trim9	UTSW	12	70267239	missense	probably benign
R9475:Trim9	UTSW	12	70346454	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- CTCATCTTGTCCAGGTCCAG -3'
(R):5'- TAAGAAAGCAGCTCTCACGG -3'

Sequencing Primer
(F):5'- GTCCAGGTCCAGATAATCATAGTCAG -3'
(R):5'- ACCGTCCGATGAGCCTC -3'

Posted On

2014-09-18