Incidental Mutation 'R2097:Galc'
ID230329
Institutional Source Beutler Lab
Gene Symbol Galc
Ensembl Gene ENSMUSG00000021003
Gene Namegalactosylceramidase
SynonymsGacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2097 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98202294-98259459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98252032 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 187 (D187G)
Ref Sequence ENSEMBL: ENSMUSP00000021390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021390]
PDB Structure
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE [X-RAY DIFFRACTION]
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE IN COMPLEX WITH GALACTOSE [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH 4NBDG: ENZYME-SUBSTRATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH D-GALACTAL: ENZYME- INTERMEDIATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH GALACTOSE: ENZYME- PRODUCT COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021390
AA Change: D187G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003
AA Change: D187G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_59 17 684 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222042
Meta Mutation Damage Score 0.1065 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Galc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Galc APN 12 98231422 missense probably benign
IGL01287:Galc APN 12 98246244 unclassified probably benign
IGL01618:Galc APN 12 98252081 missense possibly damaging 0.92
IGL02125:Galc APN 12 98231509 missense probably damaging 1.00
IGL02274:Galc APN 12 98254214 nonsense probably null
IGL02392:Galc APN 12 98207413 missense probably damaging 0.99
IGL02478:Galc APN 12 98213132 missense possibly damaging 0.96
IGL02544:Galc APN 12 98231442 missense probably benign 0.27
IGL03268:Galc APN 12 98222593 splice site probably benign
IGL03327:Galc APN 12 98207476 splice site probably benign
Crabby2 UTSW 12 98234266 missense probably damaging 1.00
Krabbe UTSW 12 98222647 missense probably damaging 1.00
lobster UTSW 12 98246255 missense probably null 0.84
quake UTSW 12 98242714 missense probably damaging 1.00
teeter UTSW 12 98259162 missense probably damaging 1.00
R0218:Galc UTSW 12 98222647 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0467:Galc UTSW 12 98242645 missense probably damaging 1.00
R1619:Galc UTSW 12 98234304 missense probably benign 0.00
R1763:Galc UTSW 12 98234266 missense probably damaging 1.00
R1832:Galc UTSW 12 98234240 critical splice donor site probably null
R1844:Galc UTSW 12 98246297 unclassified probably null
R1996:Galc UTSW 12 98252026 missense probably damaging 1.00
R2010:Galc UTSW 12 98254230 missense possibly damaging 0.51
R2496:Galc UTSW 12 98227281 missense probably damaging 1.00
R2881:Galc UTSW 12 98213096 missense probably benign
R3009:Galc UTSW 12 98203969 missense probably damaging 1.00
R4571:Galc UTSW 12 98222617 missense probably benign 0.00
R4764:Galc UTSW 12 98242744 missense possibly damaging 0.78
R4851:Galc UTSW 12 98227274 missense probably benign 0.00
R4854:Galc UTSW 12 98256877 missense probably damaging 1.00
R4900:Galc UTSW 12 98231472 missense probably damaging 1.00
R4983:Galc UTSW 12 98242768 nonsense probably null
R5220:Galc UTSW 12 98231413 splice site probably null
R5273:Galc UTSW 12 98252071 missense probably damaging 1.00
R5495:Galc UTSW 12 98231414 critical splice donor site probably null
R5689:Galc UTSW 12 98212986 missense possibly damaging 0.94
R5819:Galc UTSW 12 98216261 missense probably benign 0.06
R6191:Galc UTSW 12 98252034 missense probably damaging 1.00
R6196:Galc UTSW 12 98259162 missense probably damaging 1.00
R6305:Galc UTSW 12 98259290 missense possibly damaging 0.57
R6335:Galc UTSW 12 98242714 missense probably damaging 1.00
R7255:Galc UTSW 12 98246255 missense probably null 0.84
R7496:Galc UTSW 12 98259238 nonsense probably null
R7704:Galc UTSW 12 98208843 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTGTTATGGTGTTATGCAAC -3'
(R):5'- GCTGTCAGGATTAGTAAGAAATCTTGG -3'

Sequencing Primer
(F):5'- GCAACATGCAAAGAGTATTTCTATAC -3'
(R):5'- GGGGTCTCTCCTTTCAGCCAG -3'
Posted On2014-09-18