Incidental Mutation 'R2097:Ptpdc1'
ID 230330
Institutional Source Beutler Lab
Gene Symbol Ptpdc1
Ensembl Gene ENSMUSG00000038042
Gene Name protein tyrosine phosphatase domain containing 1
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 48577872-48625664 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 48592659 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035824] [ENSMUST00000035824] [ENSMUST00000222028] [ENSMUST00000223025]
AlphaFold Q6NZK8
Predicted Effect probably null
Transcript: ENSMUST00000035824
SMART Domains Protein: ENSMUSP00000047374
Gene: ENSMUSG00000038042

DomainStartEndE-ValueType
Pfam:DSPc 102 243 1.1e-13 PFAM
Pfam:Y_phosphatase 144 242 8.9e-10 PFAM
low complexity region 598 610 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035824
SMART Domains Protein: ENSMUSP00000047374
Gene: ENSMUSG00000038042

DomainStartEndE-ValueType
Pfam:DSPc 102 243 1.1e-13 PFAM
Pfam:Y_phosphatase 144 242 8.9e-10 PFAM
low complexity region 598 610 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221947
Predicted Effect probably null
Transcript: ENSMUST00000222028
Predicted Effect probably benign
Transcript: ENSMUST00000223025
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: The protein encoded by this gene is a centrosomal mitotic phosphatase. This protein has been implicated in centrosomal duplication and cytokinesis. In addition, knockdown of expression levels in non-cycling cells results in extra long cilia, suggesting that this protein may function in regulating cilia length independent of a function in cell cycle control. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Ptpdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Ptpdc1 APN 13 48587058 missense possibly damaging 0.80
IGL01410:Ptpdc1 APN 13 48586604 missense probably damaging 0.99
IGL02931:Ptpdc1 APN 13 48590619 splice site probably benign
IGL03180:Ptpdc1 APN 13 48586077 missense probably damaging 1.00
PIT4519001:Ptpdc1 UTSW 13 48583156 missense probably benign 0.29
PIT4687001:Ptpdc1 UTSW 13 48586290 missense probably benign 0.15
R0014:Ptpdc1 UTSW 13 48586919 nonsense probably null
R0244:Ptpdc1 UTSW 13 48585980 missense probably benign 0.00
R0420:Ptpdc1 UTSW 13 48589119 critical splice donor site probably null
R0690:Ptpdc1 UTSW 13 48586905 missense probably benign 0.33
R0946:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1076:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1387:Ptpdc1 UTSW 13 48586320 missense possibly damaging 0.85
R1459:Ptpdc1 UTSW 13 48586697 missense possibly damaging 0.62
R1688:Ptpdc1 UTSW 13 48586224 missense probably benign 0.28
R1732:Ptpdc1 UTSW 13 48586545 missense probably benign 0.00
R2570:Ptpdc1 UTSW 13 48586063 missense probably benign 0.02
R3950:Ptpdc1 UTSW 13 48589194 missense probably damaging 1.00
R4260:Ptpdc1 UTSW 13 48579758 missense probably benign 0.33
R5194:Ptpdc1 UTSW 13 48586789 missense possibly damaging 0.91
R5271:Ptpdc1 UTSW 13 48590698 missense probably damaging 1.00
R5894:Ptpdc1 UTSW 13 48590322 missense probably damaging 1.00
R5934:Ptpdc1 UTSW 13 48586369 missense probably benign 0.08
R6894:Ptpdc1 UTSW 13 48590638 missense probably benign 0.21
R7056:Ptpdc1 UTSW 13 48586990 missense possibly damaging 0.65
R7436:Ptpdc1 UTSW 13 48586666 missense probably benign 0.01
R7719:Ptpdc1 UTSW 13 48586290 missense probably benign 0.15
R7827:Ptpdc1 UTSW 13 48579788 missense probably damaging 1.00
R7969:Ptpdc1 UTSW 13 48587101 missense probably damaging 1.00
R7986:Ptpdc1 UTSW 13 48592570 missense probably damaging 1.00
R8330:Ptpdc1 UTSW 13 48597914 missense probably benign 0.00
R8500:Ptpdc1 UTSW 13 48586283 nonsense probably null
R8687:Ptpdc1 UTSW 13 48586660 missense possibly damaging 0.90
R8874:Ptpdc1 UTSW 13 48590692 missense probably damaging 1.00
R9130:Ptpdc1 UTSW 13 48586179 missense probably benign 0.04
R9284:Ptpdc1 UTSW 13 48586691 missense probably benign 0.04
R9290:Ptpdc1 UTSW 13 48586745 missense probably benign 0.02
R9309:Ptpdc1 UTSW 13 48583131 missense probably benign 0.00
R9359:Ptpdc1 UTSW 13 48586554 missense probably benign 0.38
R9369:Ptpdc1 UTSW 13 48583246 missense possibly damaging 0.95
R9661:Ptpdc1 UTSW 13 48586134 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ACACTTACCAGGATGAGTATACTCCC -3'
(R):5'- GTTCTGGACAAAATTGATCCTCTTG -3'

Sequencing Primer
(F):5'- CCAGGATGAGTATACTCCCTTAATGG -3'
(R):5'- TTGATCCTCTTGAAAAAGATGAGC -3'
Posted On 2014-09-18