Incidental Mutation 'R2097:Cts6'
ID 230331
Institutional Source Beutler Lab
Gene Symbol Cts6
Ensembl Gene ENSMUSG00000021441
Gene Name cathepsin 6
Synonyms 1600022N02Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 61342961-61351206 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61343259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 321 (N321Y)
Ref Sequence ENSEMBL: ENSMUSP00000021890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021890]
AlphaFold Q9ET52
Predicted Effect probably damaging
Transcript: ENSMUST00000021890
AA Change: N321Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021890
Gene: ENSMUSG00000021441
AA Change: N321Y

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.17e-22 SMART
Pept_C1 115 333 9.61e-111 SMART
Meta Mutation Damage Score 0.9086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Cts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Cts6 APN 13 61,346,153 (GRCm39) splice site probably benign
IGL00774:Cts6 APN 13 61,346,153 (GRCm39) splice site probably benign
IGL02237:Cts6 APN 13 61,345,313 (GRCm39) missense probably benign 0.01
IGL03071:Cts6 APN 13 61,350,064 (GRCm39) missense probably damaging 0.97
IGL03224:Cts6 APN 13 61,349,547 (GRCm39) missense probably damaging 1.00
IGL03282:Cts6 APN 13 61,344,261 (GRCm39) missense possibly damaging 0.56
R0086:Cts6 UTSW 13 61,344,271 (GRCm39) splice site probably benign
R0201:Cts6 UTSW 13 61,349,313 (GRCm39) nonsense probably null
R0238:Cts6 UTSW 13 61,349,633 (GRCm39) missense probably damaging 1.00
R0238:Cts6 UTSW 13 61,349,633 (GRCm39) missense probably damaging 1.00
R0401:Cts6 UTSW 13 61,346,153 (GRCm39) splice site probably benign
R0676:Cts6 UTSW 13 61,345,298 (GRCm39) splice site probably benign
R1471:Cts6 UTSW 13 61,344,194 (GRCm39) missense probably benign 0.00
R1594:Cts6 UTSW 13 61,346,181 (GRCm39) missense probably damaging 1.00
R1864:Cts6 UTSW 13 61,349,393 (GRCm39) missense probably benign 0.26
R1865:Cts6 UTSW 13 61,349,393 (GRCm39) missense probably benign 0.26
R1902:Cts6 UTSW 13 61,349,329 (GRCm39) nonsense probably null
R2235:Cts6 UTSW 13 61,343,247 (GRCm39) missense probably damaging 1.00
R2829:Cts6 UTSW 13 61,349,311 (GRCm39) missense probably benign 0.01
R2910:Cts6 UTSW 13 61,344,215 (GRCm39) missense probably damaging 1.00
R3757:Cts6 UTSW 13 61,349,972 (GRCm39) nonsense probably null
R4460:Cts6 UTSW 13 61,343,272 (GRCm39) missense probably benign 0.25
R4553:Cts6 UTSW 13 61,345,407 (GRCm39) missense probably damaging 1.00
R4623:Cts6 UTSW 13 61,349,974 (GRCm39) missense possibly damaging 0.57
R4793:Cts6 UTSW 13 61,349,626 (GRCm39) missense probably benign 0.00
R4809:Cts6 UTSW 13 61,349,995 (GRCm39) missense probably damaging 1.00
R4849:Cts6 UTSW 13 61,349,415 (GRCm39) missense probably null
R4866:Cts6 UTSW 13 61,350,090 (GRCm39) critical splice acceptor site probably null
R5055:Cts6 UTSW 13 61,344,164 (GRCm39) missense probably damaging 1.00
R5590:Cts6 UTSW 13 61,349,626 (GRCm39) missense probably benign 0.00
R6236:Cts6 UTSW 13 61,344,192 (GRCm39) nonsense probably null
R6428:Cts6 UTSW 13 61,344,237 (GRCm39) missense probably damaging 0.96
R6501:Cts6 UTSW 13 61,344,149 (GRCm39) missense probably damaging 1.00
R6508:Cts6 UTSW 13 61,344,221 (GRCm39) missense probably damaging 1.00
R6643:Cts6 UTSW 13 61,349,607 (GRCm39) missense probably damaging 0.96
R7397:Cts6 UTSW 13 61,350,014 (GRCm39) missense possibly damaging 0.94
R8283:Cts6 UTSW 13 61,349,457 (GRCm39) missense probably damaging 0.99
R8329:Cts6 UTSW 13 61,343,282 (GRCm39) missense probably damaging 1.00
R9009:Cts6 UTSW 13 61,344,261 (GRCm39) missense probably benign 0.04
R9438:Cts6 UTSW 13 61,350,069 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATTACTGAAGAGCAACCC -3'
(R):5'- AGTAATCAAAGTAGACCCTCTTCC -3'

Sequencing Primer
(F):5'- GTTTGACCACAAAAATTCACTAGAG -3'
(R):5'- CCTTTTCTGATACTTCTGTGAAGG -3'
Posted On 2014-09-18