Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Cts6'

230331

Institutional Source

Beutler Lab

Gene Symbol

Cts6

Ensembl Gene

ENSMUSG00000021441

Gene Name

cathepsin 6

Synonyms

MMRRC Submission

040101-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61195132-61203410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61195445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 321 (N321Y)

Ref Sequence

ENSEMBL: ENSMUSP00000021890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021890]

AlphaFold

Q9ET52

Predicted Effect

probably damaging
Transcript: ENSMUST00000021890
AA Change: N321Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021890
Gene: ENSMUSG00000021441
AA Change: N321Y

Domain	Start	End	E-Value	Type
Inhibitor_I29	29	88	3.17e-22	SMART
Pept_C1	115	333	9.61e-111	SMART

Meta Mutation Damage Score

0.9086

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Cts6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Cts6	APN	13	61198339	splice site	probably benign
IGL00774:Cts6	APN	13	61198339	splice site	probably benign
IGL02237:Cts6	APN	13	61197499	missense	probably benign	0.01
IGL03071:Cts6	APN	13	61202250	missense	probably damaging	0.97
IGL03224:Cts6	APN	13	61201733	missense	probably damaging	1.00
IGL03282:Cts6	APN	13	61196447	missense	possibly damaging	0.56
R0086:Cts6	UTSW	13	61196457	splice site	probably benign
R0201:Cts6	UTSW	13	61201499	nonsense	probably null
R0238:Cts6	UTSW	13	61201819	missense	probably damaging	1.00
R0238:Cts6	UTSW	13	61201819	missense	probably damaging	1.00
R0401:Cts6	UTSW	13	61198339	splice site	probably benign
R0676:Cts6	UTSW	13	61197484	splice site	probably benign
R1471:Cts6	UTSW	13	61196380	missense	probably benign	0.00
R1594:Cts6	UTSW	13	61198367	missense	probably damaging	1.00
R1864:Cts6	UTSW	13	61201579	missense	probably benign	0.26
R1865:Cts6	UTSW	13	61201579	missense	probably benign	0.26
R1902:Cts6	UTSW	13	61201515	nonsense	probably null
R2235:Cts6	UTSW	13	61195433	missense	probably damaging	1.00
R2829:Cts6	UTSW	13	61201497	missense	probably benign	0.01
R2910:Cts6	UTSW	13	61196401	missense	probably damaging	1.00
R3757:Cts6	UTSW	13	61202158	nonsense	probably null
R4460:Cts6	UTSW	13	61195458	missense	probably benign	0.25
R4553:Cts6	UTSW	13	61197593	missense	probably damaging	1.00
R4623:Cts6	UTSW	13	61202160	missense	possibly damaging	0.57
R4793:Cts6	UTSW	13	61201812	missense	probably benign	0.00
R4809:Cts6	UTSW	13	61202181	missense	probably damaging	1.00
R4849:Cts6	UTSW	13	61201601	missense	probably null
R4866:Cts6	UTSW	13	61202276	critical splice acceptor site	probably null
R5055:Cts6	UTSW	13	61196350	missense	probably damaging	1.00
R5590:Cts6	UTSW	13	61201812	missense	probably benign	0.00
R6236:Cts6	UTSW	13	61196378	nonsense	probably null
R6428:Cts6	UTSW	13	61196423	missense	probably damaging	0.96
R6501:Cts6	UTSW	13	61196335	missense	probably damaging	1.00
R6508:Cts6	UTSW	13	61196407	missense	probably damaging	1.00
R6643:Cts6	UTSW	13	61201793	missense	probably damaging	0.96
R7397:Cts6	UTSW	13	61202200	missense	possibly damaging	0.94
R8283:Cts6	UTSW	13	61201643	missense	probably damaging	0.99
R8329:Cts6	UTSW	13	61195468	missense	probably damaging	1.00
R9009:Cts6	UTSW	13	61196447	missense	probably benign	0.04
R9438:Cts6	UTSW	13	61202255	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCATTACTGAAGAGCAACCC -3'
(R):5'- AGTAATCAAAGTAGACCCTCTTCC -3'

Sequencing Primer
(F):5'- GTTTGACCACAAAAATTCACTAGAG -3'
(R):5'- CCTTTTCTGATACTTCTGTGAAGG -3'

Posted On

2014-09-18