Incidental Mutation 'R2097:Cts6'
ID 230331
Institutional Source Beutler Lab
Gene Symbol Cts6
Ensembl Gene ENSMUSG00000021441
Gene Name cathepsin 6
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 61195132-61203410 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61195445 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 321 (N321Y)
Ref Sequence ENSEMBL: ENSMUSP00000021890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021890]
AlphaFold Q9ET52
Predicted Effect probably damaging
Transcript: ENSMUST00000021890
AA Change: N321Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021890
Gene: ENSMUSG00000021441
AA Change: N321Y

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.17e-22 SMART
Pept_C1 115 333 9.61e-111 SMART
Meta Mutation Damage Score 0.9086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Cts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Cts6 APN 13 61198339 splice site probably benign
IGL00774:Cts6 APN 13 61198339 splice site probably benign
IGL02237:Cts6 APN 13 61197499 missense probably benign 0.01
IGL03071:Cts6 APN 13 61202250 missense probably damaging 0.97
IGL03224:Cts6 APN 13 61201733 missense probably damaging 1.00
IGL03282:Cts6 APN 13 61196447 missense possibly damaging 0.56
R0086:Cts6 UTSW 13 61196457 splice site probably benign
R0201:Cts6 UTSW 13 61201499 nonsense probably null
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0401:Cts6 UTSW 13 61198339 splice site probably benign
R0676:Cts6 UTSW 13 61197484 splice site probably benign
R1471:Cts6 UTSW 13 61196380 missense probably benign 0.00
R1594:Cts6 UTSW 13 61198367 missense probably damaging 1.00
R1864:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1865:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1902:Cts6 UTSW 13 61201515 nonsense probably null
R2235:Cts6 UTSW 13 61195433 missense probably damaging 1.00
R2829:Cts6 UTSW 13 61201497 missense probably benign 0.01
R2910:Cts6 UTSW 13 61196401 missense probably damaging 1.00
R3757:Cts6 UTSW 13 61202158 nonsense probably null
R4460:Cts6 UTSW 13 61195458 missense probably benign 0.25
R4553:Cts6 UTSW 13 61197593 missense probably damaging 1.00
R4623:Cts6 UTSW 13 61202160 missense possibly damaging 0.57
R4793:Cts6 UTSW 13 61201812 missense probably benign 0.00
R4809:Cts6 UTSW 13 61202181 missense probably damaging 1.00
R4849:Cts6 UTSW 13 61201601 missense probably null
R4866:Cts6 UTSW 13 61202276 critical splice acceptor site probably null
R5055:Cts6 UTSW 13 61196350 missense probably damaging 1.00
R5590:Cts6 UTSW 13 61201812 missense probably benign 0.00
R6236:Cts6 UTSW 13 61196378 nonsense probably null
R6428:Cts6 UTSW 13 61196423 missense probably damaging 0.96
R6501:Cts6 UTSW 13 61196335 missense probably damaging 1.00
R6508:Cts6 UTSW 13 61196407 missense probably damaging 1.00
R6643:Cts6 UTSW 13 61201793 missense probably damaging 0.96
R7397:Cts6 UTSW 13 61202200 missense possibly damaging 0.94
R8283:Cts6 UTSW 13 61201643 missense probably damaging 0.99
R8329:Cts6 UTSW 13 61195468 missense probably damaging 1.00
R9009:Cts6 UTSW 13 61196447 missense probably benign 0.04
R9438:Cts6 UTSW 13 61202255 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATTACTGAAGAGCAACCC -3'
(R):5'- AGTAATCAAAGTAGACCCTCTTCC -3'

Sequencing Primer
(F):5'- GTTTGACCACAAAAATTCACTAGAG -3'
(R):5'- CCTTTTCTGATACTTCTGTGAAGG -3'
Posted On 2014-09-18