Incidental Mutation 'R2097:Ptch1'
ID 230332
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Name patched 1
Synonyms wig, Ptc, Ptc1, A230106A15Rik, Patched 1
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 63656142-63721274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 63672773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 944 (E944A)
Ref Sequence ENSEMBL: ENSMUSP00000021921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
AlphaFold Q61115
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: E944A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: E944A

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: E807A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: E807A

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63,674,989 (GRCm39) missense probably benign 0.00
IGL01084:Ptch1 APN 13 63,691,451 (GRCm39) missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63,659,495 (GRCm39) missense probably benign
IGL02260:Ptch1 APN 13 63,713,166 (GRCm39) unclassified probably benign
IGL02439:Ptch1 APN 13 63,692,910 (GRCm39) missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63,659,732 (GRCm39) missense probably benign 0.13
IGL02797:Ptch1 APN 13 63,681,421 (GRCm39) missense probably benign
R0463:Ptch1 UTSW 13 63,668,121 (GRCm39) missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63,691,294 (GRCm39) splice site probably benign
R0657:Ptch1 UTSW 13 63,661,565 (GRCm39) missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63,687,657 (GRCm39) missense probably benign 0.23
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1466:Ptch1 UTSW 13 63,672,783 (GRCm39) missense probably benign 0.02
R1539:Ptch1 UTSW 13 63,689,101 (GRCm39) missense probably benign 0.00
R1616:Ptch1 UTSW 13 63,687,656 (GRCm39) missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63,659,841 (GRCm39) nonsense probably null
R1985:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R1986:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2024:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2025:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2026:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2027:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2096:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2100:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2105:Ptch1 UTSW 13 63,693,059 (GRCm39) missense probably benign
R2165:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2166:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2167:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2168:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2226:Ptch1 UTSW 13 63,661,485 (GRCm39) missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2504:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2507:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2696:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2698:Ptch1 UTSW 13 63,690,038 (GRCm39) missense probably damaging 1.00
R2698:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R2971:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3410:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3708:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3744:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3745:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3783:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3784:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3785:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3807:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R3950:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4013:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4015:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4016:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4017:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4035:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4083:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4084:Ptch1 UTSW 13 63,672,773 (GRCm39) missense probably benign 0.00
R4179:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63,682,143 (GRCm39) missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63,670,978 (GRCm39) missense probably benign 0.02
R4809:Ptch1 UTSW 13 63,661,522 (GRCm39) missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63,670,818 (GRCm39) missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63,670,866 (GRCm39) missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63,672,884 (GRCm39) missense probably benign 0.02
R5386:Ptch1 UTSW 13 63,692,857 (GRCm39) missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63,675,059 (GRCm39) missense probably benign
R5604:Ptch1 UTSW 13 63,672,936 (GRCm39) missense probably benign 0.01
R5846:Ptch1 UTSW 13 63,713,268 (GRCm39) unclassified probably benign
R5926:Ptch1 UTSW 13 63,692,869 (GRCm39) missense probably benign 0.01
R5945:Ptch1 UTSW 13 63,721,233 (GRCm39) utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63,672,929 (GRCm39) missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63,691,359 (GRCm39) missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63,661,503 (GRCm39) missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63,691,422 (GRCm39) missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63,670,918 (GRCm39) missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63,687,644 (GRCm39) missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63,672,881 (GRCm39) missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63,659,550 (GRCm39) missense probably benign 0.23
R7168:Ptch1 UTSW 13 63,659,874 (GRCm39) missense probably benign
R7257:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7258:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7259:Ptch1 UTSW 13 63,721,108 (GRCm39) missense not run
R7368:Ptch1 UTSW 13 63,659,798 (GRCm39) missense probably benign 0.06
R7525:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7528:Ptch1 UTSW 13 63,659,528 (GRCm39) missense probably benign 0.00
R7820:Ptch1 UTSW 13 63,670,875 (GRCm39) missense probably damaging 1.00
R8077:Ptch1 UTSW 13 63,688,626 (GRCm39) missense probably damaging 0.98
R8373:Ptch1 UTSW 13 63,688,982 (GRCm39) missense probably damaging 1.00
R8398:Ptch1 UTSW 13 63,672,939 (GRCm39) missense probably benign 0.06
R8407:Ptch1 UTSW 13 63,662,057 (GRCm39) missense probably null 1.00
R8839:Ptch1 UTSW 13 63,689,038 (GRCm39) missense probably damaging 1.00
R9075:Ptch1 UTSW 13 63,681,335 (GRCm39) missense possibly damaging 0.87
R9476:Ptch1 UTSW 13 63,681,448 (GRCm39) missense probably benign 0.05
R9514:Ptch1 UTSW 13 63,675,071 (GRCm39) missense probably benign
R9528:Ptch1 UTSW 13 63,661,615 (GRCm39) missense probably benign 0.00
R9568:Ptch1 UTSW 13 63,689,987 (GRCm39) missense probably damaging 0.99
Z1177:Ptch1 UTSW 13 63,668,093 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTCTCCCAGAGTTTTAAAGC -3'
(R):5'- CAGCAGGAGTGTGTTTACCC -3'

Sequencing Primer
(F):5'- GTCTCCCAGAGTTTTAAAGCAAAAG -3'
(R):5'- AGGAGTGTGTTTACCCCACAG -3'
Posted On 2014-09-18