Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Actr8'

230333

Institutional Source

Beutler Lab

Gene Symbol

Actr8

Ensembl Gene

ENSMUSG00000015971

Gene Name

ARP8 actin-related protein 8

Synonyms

5730542K05Rik, ARP8

MMRRC Submission

040101-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29978337-30006354 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29987228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 263 (V263A)

Ref Sequence

ENSEMBL: ENSMUSP00000153076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016115] [ENSMUST00000224797] [ENSMUST00000225811]

AlphaFold

Q8R2S9

Predicted Effect

probably damaging
Transcript: ENSMUST00000016115
AA Change: V263A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: V263A

Domain	Start	End	E-Value	Type
low complexity region	5	27	N/A	INTRINSIC
ACTIN	46	621	3.34e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198991

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224067

Predicted Effect

probably damaging
Transcript: ENSMUST00000224797
AA Change: V263A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224846

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225161

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225793

Predicted Effect

probably benign
Transcript: ENSMUST00000225811

Meta Mutation Damage Score

0.6142

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Actr8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Actr8	APN	14	29988335	missense	probably damaging	1.00
IGL01449:Actr8	APN	14	29990970	critical splice donor site	probably null
IGL01577:Actr8	APN	14	29987275	missense	probably benign
IGL02118:Actr8	APN	14	29982771	critical splice donor site	probably null
IGL02647:Actr8	APN	14	29990890	missense	probably damaging	1.00
IGL02659:Actr8	APN	14	29986341	missense	probably damaging	1.00
IGL02696:Actr8	APN	14	29982671	missense	probably benign	0.33
IGL03015:Actr8	APN	14	29986316	missense	possibly damaging	0.81
IGL03335:Actr8	APN	14	29978557	missense	probably benign
R0512:Actr8	UTSW	14	29978556	missense	probably benign	0.00
R0735:Actr8	UTSW	14	29989712	missense	probably benign	0.02
R0926:Actr8	UTSW	14	29987224	missense	probably benign	0.02
R1443:Actr8	UTSW	14	29984099	missense	possibly damaging	0.73
R1470:Actr8	UTSW	14	29986969	missense	possibly damaging	0.90
R1470:Actr8	UTSW	14	29986969	missense	possibly damaging	0.90
R1616:Actr8	UTSW	14	29982644	missense	possibly damaging	0.53
R2240:Actr8	UTSW	14	29989757	missense	possibly damaging	0.94
R2570:Actr8	UTSW	14	29987282	missense	probably damaging	1.00
R5122:Actr8	UTSW	14	29982715	missense	possibly damaging	0.95
R5439:Actr8	UTSW	14	29986995	missense	probably damaging	1.00
R5697:Actr8	UTSW	14	29991673	missense	possibly damaging	0.73
R5727:Actr8	UTSW	14	29990881	missense	probably benign	0.01
R5860:Actr8	UTSW	14	29986285	nonsense	probably null
R5988:Actr8	UTSW	14	29993073	missense	possibly damaging	0.71
R6006:Actr8	UTSW	14	29984142	critical splice donor site	probably null
R6009:Actr8	UTSW	14	29978497	unclassified	probably benign
R6155:Actr8	UTSW	14	29978589	critical splice donor site	probably null
R6190:Actr8	UTSW	14	29991717	nonsense	probably null
R6329:Actr8	UTSW	14	29993084	nonsense	probably null
R6483:Actr8	UTSW	14	29978581	missense	possibly damaging	0.53
R6517:Actr8	UTSW	14	29982716	nonsense	probably null
R6562:Actr8	UTSW	14	29986454	splice site	probably null
R7484:Actr8	UTSW	14	29992968	missense	probably damaging	1.00
R8190:Actr8	UTSW	14	29984073	missense	possibly damaging	0.66
R8236:Actr8	UTSW	14	29982628	missense	probably damaging	1.00
R8516:Actr8	UTSW	14	29990899	missense	probably benign	0.17
R9484:Actr8	UTSW	14	29986344	missense	probably benign	0.19
Z1177:Actr8	UTSW	14	29986401	missense	probably damaging	1.00
Z1177:Actr8	UTSW	14	29987242	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCACTGAACGCACTGACTTAG -3'
(R):5'- AGAACTGACAGCCCAGTCTC -3'

Sequencing Primer
(F):5'- CGCACTGACTTAGTTACATGTG -3'
(R):5'- TTTCTGGCCGGTAGACAGAC -3'

Posted On

2014-09-18