Incidental Mutation 'R2097:Apol6'
ID 230335
Institutional Source Beutler Lab
Gene Symbol Apol6
Ensembl Gene ENSMUSG00000033576
Gene Name apolipoprotein L 6
Synonyms 2310076O14Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 76929195-76941308 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 76931333 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127957] [ENSMUST00000127957] [ENSMUST00000129468] [ENSMUST00000129468] [ENSMUST00000142405] [ENSMUST00000149569] [ENSMUST00000149569] [ENSMUST00000152949] [ENSMUST00000152949] [ENSMUST00000166179] [ENSMUST00000229423]
AlphaFold B7ZC55
Predicted Effect probably null
Transcript: ENSMUST00000127957
SMART Domains Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 15 290 4.1e-76 PFAM
transmembrane domain 294 311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127957
SMART Domains Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 15 290 4.1e-76 PFAM
transmembrane domain 294 311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129468
Predicted Effect probably null
Transcript: ENSMUST00000129468
Predicted Effect probably benign
Transcript: ENSMUST00000142405
SMART Domains Protein: ENSMUSP00000117135
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148197
Predicted Effect probably null
Transcript: ENSMUST00000149569
SMART Domains Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 290 7e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149569
SMART Domains Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 290 7e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152949
SMART Domains Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 263 2.7e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152949
SMART Domains Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 263 2.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166179
SMART Domains Protein: ENSMUSP00000128399
Gene: ENSMUSG00000018893

DomainStartEndE-ValueType
Pfam:Globin 7 113 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229423
Meta Mutation Damage Score 0.9365 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Apol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Apol6 APN 15 76,934,916 (GRCm39) missense probably damaging 1.00
IGL01788:Apol6 APN 15 76,935,216 (GRCm39) missense possibly damaging 0.81
FR4304:Apol6 UTSW 15 76,935,636 (GRCm39) frame shift probably null
FR4449:Apol6 UTSW 15 76,935,643 (GRCm39) nonsense probably null
FR4548:Apol6 UTSW 15 76,935,645 (GRCm39) frame shift probably null
FR4589:Apol6 UTSW 15 76,935,638 (GRCm39) frame shift probably null
FR4737:Apol6 UTSW 15 76,935,642 (GRCm39) frame shift probably null
R0350:Apol6 UTSW 15 76,935,147 (GRCm39) nonsense probably null
R1167:Apol6 UTSW 15 76,931,308 (GRCm39) nonsense probably null
R1906:Apol6 UTSW 15 76,935,060 (GRCm39) missense probably damaging 0.99
R1996:Apol6 UTSW 15 76,934,956 (GRCm39) missense probably benign 0.28
R5611:Apol6 UTSW 15 76,935,240 (GRCm39) splice site probably null
R5980:Apol6 UTSW 15 76,935,219 (GRCm39) missense possibly damaging 0.66
R6191:Apol6 UTSW 15 76,940,098 (GRCm39) missense probably benign 0.00
R6300:Apol6 UTSW 15 76,935,471 (GRCm39) missense probably benign 0.01
R6519:Apol6 UTSW 15 76,935,476 (GRCm39) nonsense probably null
R7569:Apol6 UTSW 15 76,934,898 (GRCm39) unclassified probably benign
R8072:Apol6 UTSW 15 76,935,303 (GRCm39) missense probably benign 0.03
R9010:Apol6 UTSW 15 76,935,697 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGCACAGTCTAAAATCCTTCCTTAC -3'
(R):5'- TTTCCACACAGTGATCCTGGAG -3'

Sequencing Primer
(F):5'- ACTTGAATTTTACAATGTTGCATGC -3'
(R):5'- CCATGATGGTAATGGACTAGCCTC -3'
Posted On 2014-09-18