Mutagenetix > Incidental Mutations

Incidental Mutation 'R2097:Apol6'

230335

Institutional Source

Beutler Lab

Gene Symbol

Apol6

Ensembl Gene

ENSMUSG00000033576

Gene Name

apolipoprotein L 6

Synonyms

MMRRC Submission

040101-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77044729-77057106 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 77047133 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127957] [ENSMUST00000127957] [ENSMUST00000129468] [ENSMUST00000129468] [ENSMUST00000142405] [ENSMUST00000149569] [ENSMUST00000149569] [ENSMUST00000152949] [ENSMUST00000152949] [ENSMUST00000166179] [ENSMUST00000229423]

Predicted Effect

probably null
Transcript: ENSMUST00000127957

SMART Domains

Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576

Domain	Start	End	E-Value	Type
Pfam:ApoL	15	290	4.1e-76	PFAM
transmembrane domain	294	311	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000127957

SMART Domains

Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576

Domain	Start	End	E-Value	Type
Pfam:ApoL	15	290	4.1e-76	PFAM
transmembrane domain	294	311	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000129468

Predicted Effect

probably null
Transcript: ENSMUST00000129468

Predicted Effect

probably benign
Transcript: ENSMUST00000142405

SMART Domains

Protein: ENSMUSP00000117135
Gene: ENSMUSG00000033576

Domain	Start	End	E-Value	Type
low complexity region	22	43	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148197

Predicted Effect

probably null
Transcript: ENSMUST00000149569

SMART Domains

Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576

Domain	Start	End	E-Value	Type
Pfam:ApoL	10	290	7e-98	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000149569

SMART Domains

Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576

Domain	Start	End	E-Value	Type
Pfam:ApoL	10	290	7e-98	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000152949

SMART Domains

Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576

Domain	Start	End	E-Value	Type
Pfam:ApoL	10	263	2.7e-87	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000152949

SMART Domains

Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576

Domain	Start	End	E-Value	Type
Pfam:ApoL	10	263	2.7e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166179

SMART Domains

Protein: ENSMUSP00000128399
Gene: ENSMUSG00000018893

Domain	Start	End	E-Value	Type
Pfam:Globin	7	113	1.1e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229423

Meta Mutation Damage Score

0.9365

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Msh6	A	G	17: 87,985,416	N533S	probably benign	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Apol6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01598:Apol6	APN	15	77050716	missense	probably damaging	1.00
IGL01788:Apol6	APN	15	77051016	missense	possibly damaging	0.81
FR4304:Apol6	UTSW	15	77051436	frame shift	probably null
FR4449:Apol6	UTSW	15	77051443	nonsense	probably null
FR4548:Apol6	UTSW	15	77051445	frame shift	probably null
FR4589:Apol6	UTSW	15	77051438	frame shift	probably null
FR4737:Apol6	UTSW	15	77051442	frame shift	probably null
R0350:Apol6	UTSW	15	77050947	nonsense	probably null
R1167:Apol6	UTSW	15	77047108	nonsense	probably null
R1906:Apol6	UTSW	15	77050860	missense	probably damaging	0.99
R1996:Apol6	UTSW	15	77050756	missense	probably benign	0.28
R5611:Apol6	UTSW	15	77051040	splice site	probably null
R5980:Apol6	UTSW	15	77051019	missense	possibly damaging	0.66
R6191:Apol6	UTSW	15	77055898	missense	probably benign	0.00
R6300:Apol6	UTSW	15	77051271	missense	probably benign	0.01
R6519:Apol6	UTSW	15	77051276	nonsense	probably null
R7569:Apol6	UTSW	15	77050698	unclassified	probably benign
R8072:Apol6	UTSW	15	77051103	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGCACAGTCTAAAATCCTTCCTTAC -3'
(R):5'- TTTCCACACAGTGATCCTGGAG -3'

Sequencing Primer
(F):5'- ACTTGAATTTTACAATGTTGCATGC -3'
(R):5'- CCATGATGGTAATGGACTAGCCTC -3'

Posted On

2014-09-18