Incidental Mutation 'R2097:Apol6'
ID230335
Institutional Source Beutler Lab
Gene Symbol Apol6
Ensembl Gene ENSMUSG00000033576
Gene Nameapolipoprotein L 6
Synonyms
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2097 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location77044729-77057106 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 77047133 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127957] [ENSMUST00000127957] [ENSMUST00000129468] [ENSMUST00000129468] [ENSMUST00000142405] [ENSMUST00000149569] [ENSMUST00000149569] [ENSMUST00000152949] [ENSMUST00000152949] [ENSMUST00000166179] [ENSMUST00000229423]
Predicted Effect probably null
Transcript: ENSMUST00000127957
SMART Domains Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 15 290 4.1e-76 PFAM
transmembrane domain 294 311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127957
SMART Domains Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 15 290 4.1e-76 PFAM
transmembrane domain 294 311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129468
Predicted Effect probably null
Transcript: ENSMUST00000129468
Predicted Effect probably benign
Transcript: ENSMUST00000142405
SMART Domains Protein: ENSMUSP00000117135
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148197
Predicted Effect probably null
Transcript: ENSMUST00000149569
SMART Domains Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 290 7e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149569
SMART Domains Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 290 7e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152949
SMART Domains Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 263 2.7e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152949
SMART Domains Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
Pfam:ApoL 10 263 2.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166179
SMART Domains Protein: ENSMUSP00000128399
Gene: ENSMUSG00000018893

DomainStartEndE-ValueType
Pfam:Globin 7 113 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229423
Meta Mutation Damage Score 0.9365 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hacd2 A G 16: 35,048,720 I92V probably benign Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Apol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Apol6 APN 15 77050716 missense probably damaging 1.00
IGL01788:Apol6 APN 15 77051016 missense possibly damaging 0.81
FR4304:Apol6 UTSW 15 77051436 frame shift probably null
FR4449:Apol6 UTSW 15 77051443 nonsense probably null
FR4548:Apol6 UTSW 15 77051445 frame shift probably null
FR4589:Apol6 UTSW 15 77051438 frame shift probably null
FR4737:Apol6 UTSW 15 77051442 frame shift probably null
R0350:Apol6 UTSW 15 77050947 nonsense probably null
R1167:Apol6 UTSW 15 77047108 nonsense probably null
R1906:Apol6 UTSW 15 77050860 missense probably damaging 0.99
R1996:Apol6 UTSW 15 77050756 missense probably benign 0.28
R5611:Apol6 UTSW 15 77051040 splice site probably null
R5980:Apol6 UTSW 15 77051019 missense possibly damaging 0.66
R6191:Apol6 UTSW 15 77055898 missense probably benign 0.00
R6300:Apol6 UTSW 15 77051271 missense probably benign 0.01
R6519:Apol6 UTSW 15 77051276 nonsense probably null
R7569:Apol6 UTSW 15 77050698 unclassified probably benign
R8072:Apol6 UTSW 15 77051103 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCACAGTCTAAAATCCTTCCTTAC -3'
(R):5'- TTTCCACACAGTGATCCTGGAG -3'

Sequencing Primer
(F):5'- ACTTGAATTTTACAATGTTGCATGC -3'
(R):5'- CCATGATGGTAATGGACTAGCCTC -3'
Posted On2014-09-18