Incidental Mutation 'R2097:Hacd2'
ID 230337
Institutional Source Beutler Lab
Gene Symbol Hacd2
Ensembl Gene ENSMUSG00000035376
Gene Name 3-hydroxyacyl-CoA dehydratase 2
Synonyms Ptplb, 6330408J20Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 34842798-34929547 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34869090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 92 (I92V)
Ref Sequence ENSEMBL: ENSMUSP00000060462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061156]
AlphaFold Q9D3B1
Predicted Effect probably benign
Transcript: ENSMUST00000061156
AA Change: I92V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000060462
Gene: ENSMUSG00000035376
AA Change: I92V

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 12 27 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:PTPLA 85 246 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231556
Meta Mutation Damage Score 0.1355 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can catalyze the third step (dehydration) in the conversion of long chain fatty acids to very long chain fatty acids. The encoded protein localizes to the endoplasmic reticulum membrane. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Hacd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Hacd2 APN 16 34,869,083 (GRCm39) splice site probably benign
IGL02454:Hacd2 APN 16 34,926,761 (GRCm39) missense probably benign 0.03
R0057:Hacd2 UTSW 16 34,895,997 (GRCm39) missense probably damaging 1.00
R0057:Hacd2 UTSW 16 34,895,997 (GRCm39) missense probably damaging 1.00
R1831:Hacd2 UTSW 16 34,922,434 (GRCm39) missense probably damaging 1.00
R1945:Hacd2 UTSW 16 34,922,354 (GRCm39) missense possibly damaging 0.82
R2392:Hacd2 UTSW 16 34,926,748 (GRCm39) missense probably benign 0.04
R4962:Hacd2 UTSW 16 34,842,921 (GRCm39) missense unknown
R5731:Hacd2 UTSW 16 34,922,374 (GRCm39) missense probably damaging 1.00
R7751:Hacd2 UTSW 16 34,922,434 (GRCm39) missense probably damaging 1.00
R7850:Hacd2 UTSW 16 34,922,477 (GRCm39) missense probably damaging 1.00
R9101:Hacd2 UTSW 16 34,920,156 (GRCm39) missense probably benign 0.43
Z1176:Hacd2 UTSW 16 34,926,695 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAACAAACCACTGTGTGAGG -3'
(R):5'- AGAGCTTCCCTGTTGTGCTG -3'

Sequencing Primer
(F):5'- CAAACCACTGTGTGAGGATTAAATC -3'
(R):5'- CAACAAATAATGGTATGTGGTGGTG -3'
Posted On 2014-09-18