Incidental Mutation 'R2097:Hacd2'
ID 230337
Institutional Source Beutler Lab
Gene Symbol Hacd2
Ensembl Gene ENSMUSG00000035376
Gene Name 3-hydroxyacyl-CoA dehydratase 2
Synonyms 6330408J20Rik, Ptplb
MMRRC Submission 040101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 35022428-35109177 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35048720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 92 (I92V)
Ref Sequence ENSEMBL: ENSMUSP00000060462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061156]
AlphaFold Q9D3B1
Predicted Effect probably benign
Transcript: ENSMUST00000061156
AA Change: I92V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000060462
Gene: ENSMUSG00000035376
AA Change: I92V

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 12 27 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
Pfam:PTPLA 85 246 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231556
Meta Mutation Damage Score 0.1355 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can catalyze the third step (dehydration) in the conversion of long chain fatty acids to very long chain fatty acids. The encoded protein localizes to the endoplasmic reticulum membrane. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,181,964 R29* probably null Het
Actr8 T C 14: 29,987,228 V263A probably damaging Het
Apol6 T A 15: 77,047,133 probably null Het
Aqp3 C T 4: 41,098,004 V36M possibly damaging Het
Bace1 G T 9: 45,860,222 C478F probably benign Het
Bbof1 C A 12: 84,413,307 A116D probably damaging Het
Casq1 A T 1: 172,210,421 L381Q probably damaging Het
Ccdc138 T A 10: 58,561,937 L533* probably null Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cntn6 A G 6: 104,861,949 E988G probably damaging Het
Cts6 T A 13: 61,195,445 N321Y probably damaging Het
Dnmt1 A G 9: 20,909,788 S1269P probably benign Het
Dsg4 C A 18: 20,471,044 P856H probably damaging Het
Fndc3a C A 14: 72,574,351 probably null Het
Galc T C 12: 98,252,032 D187G probably benign Het
Gfm1 T C 3: 67,449,746 I384T probably damaging Het
Hmcn2 T A 2: 31,380,419 Y1223N probably damaging Het
Il20ra T C 10: 19,759,463 I484T probably damaging Het
Map7 G T 10: 20,246,616 V143F probably damaging Het
Mcm3ap T C 10: 76,512,489 L1893P probably damaging Het
Msh6 A G 17: 87,985,416 N533S probably benign Het
Nbea T C 3: 55,723,217 D2233G probably damaging Het
Nlrp6 A T 7: 140,923,204 T408S probably damaging Het
Notch3 A T 17: 32,122,754 L2008Q probably damaging Het
Olfr1051 A T 2: 86,276,039 Y149* probably null Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pggt1b T C 18: 46,246,628 N296D probably benign Het
Pglyrp3 T A 3: 92,028,171 F243I possibly damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpdc1 T A 13: 48,592,659 probably null Het
Ptprq T C 10: 107,653,493 T924A probably benign Het
Pwp2 C A 10: 78,177,742 probably benign Het
Slc7a4 G T 16: 17,573,455 probably null Het
Tmem132b T A 5: 125,638,208 I327K probably damaging Het
Trim9 T C 12: 70,347,159 M4V probably damaging Het
Tspan13 T C 12: 36,021,830 S128G probably benign Het
Ttc25 T A 11: 100,563,582 F398I possibly damaging Het
Zbtb20 A G 16: 43,609,519 D131G probably null Het
Zeb2 A T 2: 44,997,156 C615S probably damaging Het
Zfp777 C T 6: 48,044,242 D149N probably benign Het
Zfp990 A G 4: 145,537,322 K297E possibly damaging Het
Other mutations in Hacd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Hacd2 APN 16 35048713 splice site probably benign
IGL02454:Hacd2 APN 16 35106391 missense probably benign 0.03
R0057:Hacd2 UTSW 16 35075627 missense probably damaging 1.00
R0057:Hacd2 UTSW 16 35075627 missense probably damaging 1.00
R1831:Hacd2 UTSW 16 35102064 missense probably damaging 1.00
R1945:Hacd2 UTSW 16 35101984 missense possibly damaging 0.82
R2392:Hacd2 UTSW 16 35106378 missense probably benign 0.04
R4962:Hacd2 UTSW 16 35022551 missense unknown
R5731:Hacd2 UTSW 16 35102004 missense probably damaging 1.00
R7751:Hacd2 UTSW 16 35102064 missense probably damaging 1.00
R7850:Hacd2 UTSW 16 35102107 missense probably damaging 1.00
R9101:Hacd2 UTSW 16 35099786 missense probably benign 0.43
Z1176:Hacd2 UTSW 16 35106325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAACAAACCACTGTGTGAGG -3'
(R):5'- AGAGCTTCCCTGTTGTGCTG -3'

Sequencing Primer
(F):5'- CAAACCACTGTGTGAGGATTAAATC -3'
(R):5'- CAACAAATAATGGTATGTGGTGGTG -3'
Posted On 2014-09-18