Incidental Mutation 'R2097:Zbtb20'
ID 230338
Institutional Source Beutler Lab
Gene Symbol Zbtb20
Ensembl Gene ENSMUSG00000022708
Gene Name zinc finger and BTB domain containing 20
Synonyms D16Wsu73e, Zfp288, HOF, 7330412A13Rik, 1300017A20Rik, A930017C21Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2097 (G1)
Quality Score 146
Status Validated
Chromosome 16
Chromosomal Location 42728008-43462981 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43429882 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 131 (D131G)
Ref Sequence ENSEMBL: ENSMUSP00000124126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]
AlphaFold Q8K0L9
Predicted Effect probably damaging
Transcript: ENSMUST00000079441
AA Change: D131G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: D131G

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114690
AA Change: D58G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: D58G

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114691
AA Change: D58G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: D58G

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114694
AA Change: D131G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: D131G

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114695
AA Change: D131G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: D131G

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146708
AA Change: D58G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708
AA Change: D58G

DomainStartEndE-ValueType
Pfam:BTB 21 74 3.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148775
AA Change: D58G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708
AA Change: D58G

DomainStartEndE-ValueType
Pfam:BTB 21 60 9.8e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156367
AA Change: D131G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708
AA Change: D131G

DomainStartEndE-ValueType
Pfam:BTB 94 131 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156981
AA Change: D58G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708
AA Change: D58G

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
Meta Mutation Damage Score 0.8641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Zbtb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Zbtb20 APN 16 43,431,024 (GRCm39) missense possibly damaging 0.85
IGL02170:Zbtb20 APN 16 43,430,025 (GRCm39) missense possibly damaging 0.84
IGL02292:Zbtb20 APN 16 43,431,011 (GRCm39) nonsense probably null
IGL02733:Zbtb20 APN 16 43,430,296 (GRCm39) missense possibly damaging 0.48
IGL03277:Zbtb20 APN 16 43,438,800 (GRCm39) missense possibly damaging 0.95
siberian UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
Tiger UTSW 16 43,438,761 (GRCm39) missense probably damaging 0.98
Towering UTSW 16 43,431,230 (GRCm39) nonsense probably null
R0310:Zbtb20 UTSW 16 43,430,109 (GRCm39) missense probably damaging 0.98
R1593:Zbtb20 UTSW 16 43,429,786 (GRCm39) missense probably damaging 0.99
R1996:Zbtb20 UTSW 16 43,430,443 (GRCm39) missense probably damaging 0.98
R2018:Zbtb20 UTSW 16 43,398,015 (GRCm39) missense possibly damaging 0.86
R2050:Zbtb20 UTSW 16 43,429,975 (GRCm39) splice site probably null
R4006:Zbtb20 UTSW 16 43,429,762 (GRCm39) missense probably damaging 1.00
R4708:Zbtb20 UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
R4710:Zbtb20 UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
R4835:Zbtb20 UTSW 16 43,438,761 (GRCm39) missense probably damaging 0.98
R4962:Zbtb20 UTSW 16 43,439,055 (GRCm39) missense probably damaging 0.99
R5531:Zbtb20 UTSW 16 43,431,230 (GRCm39) nonsense probably null
R7452:Zbtb20 UTSW 16 43,431,039 (GRCm39) missense probably damaging 0.96
R7523:Zbtb20 UTSW 16 43,430,875 (GRCm39) missense probably benign 0.01
R8175:Zbtb20 UTSW 16 43,397,443 (GRCm39) intron probably benign
R8306:Zbtb20 UTSW 16 43,439,100 (GRCm39) missense probably damaging 0.99
R8811:Zbtb20 UTSW 16 43,430,857 (GRCm39) missense probably benign
R8922:Zbtb20 UTSW 16 43,397,968 (GRCm39) missense probably damaging 0.99
R9164:Zbtb20 UTSW 16 43,430,764 (GRCm39) missense probably benign 0.02
R9687:Zbtb20 UTSW 16 43,430,160 (GRCm39) missense possibly damaging 0.83
Z1176:Zbtb20 UTSW 16 43,430,893 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTAAACTACAGGTGACATCAGTTGC -3'
(R):5'- GTTCTGTGACACGATGCGAG -3'

Sequencing Primer
(F):5'- CATCAGTTGCAAGGGGATGACC -3'
(R):5'- GCGAGTGCACTCATCTATGACTG -3'
Posted On 2014-09-18