Incidental Mutation 'R2097:Msh6'
ID 230340
Institutional Source Beutler Lab
Gene Symbol Msh6
Ensembl Gene ENSMUSG00000005370
Gene Name mutS homolog 6
Synonyms Gtmbp, GTBP, Msh6
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 88282490-88298320 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88292844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 533 (N533S)
Ref Sequence ENSEMBL: ENSMUSP00000005503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005503]
AlphaFold P54276
Predicted Effect probably benign
Transcript: ENSMUST00000005503
AA Change: N533S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: N533S

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
PWWP 90 152 9.01e-30 SMART
low complexity region 198 212 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 373 389 N/A INTRINSIC
Pfam:MutS_I 406 525 4.7e-35 PFAM
Pfam:MutS_II 536 700 1.4e-10 PFAM
MUTSd 750 1100 4.56e-86 SMART
MUTSac 1125 1319 1.68e-116 SMART
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pggt1b T C 18: 46,379,695 (GRCm39) N296D probably benign Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Msh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Msh6 APN 17 88,292,907 (GRCm39) missense probably benign
IGL01834:Msh6 APN 17 88,293,140 (GRCm39) missense probably damaging 1.00
IGL01904:Msh6 APN 17 88,292,160 (GRCm39) missense probably benign
IGL01957:Msh6 APN 17 88,292,519 (GRCm39) missense possibly damaging 0.73
IGL02117:Msh6 APN 17 88,298,234 (GRCm39) unclassified probably benign
IGL02234:Msh6 APN 17 88,294,229 (GRCm39) missense probably damaging 1.00
IGL02512:Msh6 APN 17 88,292,160 (GRCm39) missense probably benign
IGL02651:Msh6 APN 17 88,296,943 (GRCm39) missense probably damaging 1.00
IGL03381:Msh6 APN 17 88,292,537 (GRCm39) missense probably damaging 1.00
medea UTSW 17 88,287,651 (GRCm39) nonsense probably null
medusa UTSW 17 88,295,891 (GRCm39) unclassified probably benign
PIT4449001:Msh6 UTSW 17 88,293,616 (GRCm39) missense probably damaging 0.96
R0196:Msh6 UTSW 17 88,287,788 (GRCm39) missense possibly damaging 0.95
R0324:Msh6 UTSW 17 88,294,048 (GRCm39) nonsense probably null
R0492:Msh6 UTSW 17 88,282,679 (GRCm39) missense probably benign
R0711:Msh6 UTSW 17 88,294,112 (GRCm39) missense probably damaging 1.00
R1065:Msh6 UTSW 17 88,295,891 (GRCm39) unclassified probably benign
R1454:Msh6 UTSW 17 88,292,186 (GRCm39) missense probably benign 0.00
R1740:Msh6 UTSW 17 88,293,150 (GRCm39) missense possibly damaging 0.72
R1770:Msh6 UTSW 17 88,287,651 (GRCm39) nonsense probably null
R1771:Msh6 UTSW 17 88,291,950 (GRCm39) missense probably benign 0.17
R1919:Msh6 UTSW 17 88,292,553 (GRCm39) missense probably benign 0.01
R1926:Msh6 UTSW 17 88,293,653 (GRCm39) missense probably benign
R2026:Msh6 UTSW 17 88,297,771 (GRCm39) missense probably damaging 1.00
R2095:Msh6 UTSW 17 88,295,661 (GRCm39) missense possibly damaging 0.93
R2149:Msh6 UTSW 17 88,293,516 (GRCm39) missense probably damaging 1.00
R2156:Msh6 UTSW 17 88,293,568 (GRCm39) nonsense probably null
R2167:Msh6 UTSW 17 88,296,911 (GRCm39) missense probably damaging 1.00
R2382:Msh6 UTSW 17 88,292,159 (GRCm39) missense probably benign
R3005:Msh6 UTSW 17 88,295,713 (GRCm39) missense probably benign 0.34
R3160:Msh6 UTSW 17 88,292,909 (GRCm39) missense probably damaging 1.00
R3162:Msh6 UTSW 17 88,292,909 (GRCm39) missense probably damaging 1.00
R3162:Msh6 UTSW 17 88,292,909 (GRCm39) missense probably damaging 1.00
R3774:Msh6 UTSW 17 88,293,609 (GRCm39) missense probably damaging 1.00
R3775:Msh6 UTSW 17 88,293,609 (GRCm39) missense probably damaging 1.00
R4350:Msh6 UTSW 17 88,292,012 (GRCm39) missense probably damaging 1.00
R4424:Msh6 UTSW 17 88,298,217 (GRCm39) nonsense probably null
R4499:Msh6 UTSW 17 88,287,697 (GRCm39) missense probably damaging 1.00
R4667:Msh6 UTSW 17 88,292,234 (GRCm39) missense possibly damaging 0.89
R4668:Msh6 UTSW 17 88,292,234 (GRCm39) missense possibly damaging 0.89
R4669:Msh6 UTSW 17 88,292,234 (GRCm39) missense possibly damaging 0.89
R4849:Msh6 UTSW 17 88,290,947 (GRCm39) missense possibly damaging 0.94
R5137:Msh6 UTSW 17 88,287,716 (GRCm39) missense possibly damaging 0.83
R5472:Msh6 UTSW 17 88,291,989 (GRCm39) missense possibly damaging 0.81
R5594:Msh6 UTSW 17 88,293,497 (GRCm39) missense probably benign 0.00
R5607:Msh6 UTSW 17 88,294,329 (GRCm39) missense probably damaging 1.00
R5608:Msh6 UTSW 17 88,294,329 (GRCm39) missense probably damaging 1.00
R5660:Msh6 UTSW 17 88,292,147 (GRCm39) missense possibly damaging 0.94
R6243:Msh6 UTSW 17 88,290,999 (GRCm39) missense possibly damaging 0.69
R6279:Msh6 UTSW 17 88,287,677 (GRCm39) missense probably damaging 1.00
R6357:Msh6 UTSW 17 88,291,888 (GRCm39) nonsense probably null
R6399:Msh6 UTSW 17 88,294,319 (GRCm39) missense probably damaging 1.00
R6453:Msh6 UTSW 17 88,293,167 (GRCm39) missense probably damaging 1.00
R6646:Msh6 UTSW 17 88,293,870 (GRCm39) missense possibly damaging 0.80
R7404:Msh6 UTSW 17 88,282,548 (GRCm39)
R7837:Msh6 UTSW 17 88,292,094 (GRCm39) missense probably damaging 1.00
R8004:Msh6 UTSW 17 88,294,215 (GRCm39) missense probably damaging 1.00
R8296:Msh6 UTSW 17 88,294,340 (GRCm39) missense probably damaging 1.00
R8326:Msh6 UTSW 17 88,294,340 (GRCm39) missense probably damaging 1.00
R8377:Msh6 UTSW 17 88,292,598 (GRCm39) missense probably damaging 1.00
R8715:Msh6 UTSW 17 88,293,195 (GRCm39) missense probably benign
R9752:Msh6 UTSW 17 88,293,963 (GRCm39) missense probably damaging 1.00
X0026:Msh6 UTSW 17 88,298,042 (GRCm39) missense probably benign 0.00
X0026:Msh6 UTSW 17 88,293,609 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCGGATTCCTTGGTGCAG -3'
(R):5'- CTGTTGAGAGATTTCCTTTCTCGAAC -3'

Sequencing Primer
(F):5'- ATTCCTTGGTGCAGAAGGGCTATAAG -3'
(R):5'- CTCGAACAAAATTTGTACTGGAGG -3'
Posted On 2014-09-18