Mutagenetix > Incidental Mutation

Incidental Mutation 'R2097:Msh6'

230340

Institutional Source

Beutler Lab

Gene Symbol

Msh6

Ensembl Gene

ENSMUSG00000005370

Gene Name

mutS homolog 6

Synonyms

GTBP, Gtmbp, Msh6

MMRRC Submission

040101-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87975050-87990883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87985416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 533 (N533S)

Ref Sequence

ENSEMBL: ENSMUSP00000005503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005503]

AlphaFold

P54276

Predicted Effect

probably benign
Transcript: ENSMUST00000005503
AA Change: N533S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: N533S

Domain	Start	End	E-Value	Type
low complexity region	23	46	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
PWWP	90	152	9.01e-30	SMART
low complexity region	198	212	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
low complexity region	273	291	N/A	INTRINSIC
low complexity region	373	389	N/A	INTRINSIC
Pfam:MutS_I	406	525	4.7e-35	PFAM
Pfam:MutS_II	536	700	1.4e-10	PFAM
MUTSd	750	1100	4.56e-86	SMART
MUTSac	1125	1319	1.68e-116	SMART

Meta Mutation Damage Score

0.0605

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,181,964	R29*	probably null	Het
Actr8	T	C	14: 29,987,228	V263A	probably damaging	Het
Apol6	T	A	15: 77,047,133		probably null	Het
Aqp3	C	T	4: 41,098,004	V36M	possibly damaging	Het
Bace1	G	T	9: 45,860,222	C478F	probably benign	Het
Bbof1	C	A	12: 84,413,307	A116D	probably damaging	Het
Casq1	A	T	1: 172,210,421	L381Q	probably damaging	Het
Ccdc138	T	A	10: 58,561,937	L533*	probably null	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Cntn6	A	G	6: 104,861,949	E988G	probably damaging	Het
Cts6	T	A	13: 61,195,445	N321Y	probably damaging	Het
Dnmt1	A	G	9: 20,909,788	S1269P	probably benign	Het
Dsg4	C	A	18: 20,471,044	P856H	probably damaging	Het
Fndc3a	C	A	14: 72,574,351		probably null	Het
Galc	T	C	12: 98,252,032	D187G	probably benign	Het
Gfm1	T	C	3: 67,449,746	I384T	probably damaging	Het
Hacd2	A	G	16: 35,048,720	I92V	probably benign	Het
Hmcn2	T	A	2: 31,380,419	Y1223N	probably damaging	Het
Il20ra	T	C	10: 19,759,463	I484T	probably damaging	Het
Map7	G	T	10: 20,246,616	V143F	probably damaging	Het
Mcm3ap	T	C	10: 76,512,489	L1893P	probably damaging	Het
Nbea	T	C	3: 55,723,217	D2233G	probably damaging	Het
Nlrp6	A	T	7: 140,923,204	T408S	probably damaging	Het
Notch3	A	T	17: 32,122,754	L2008Q	probably damaging	Het
Olfr1051	A	T	2: 86,276,039	Y149*	probably null	Het
Olfr603	T	A	7: 103,383,633	D123V	probably damaging	Het
Pggt1b	T	C	18: 46,246,628	N296D	probably benign	Het
Pglyrp3	T	A	3: 92,028,171	F243I	possibly damaging	Het
Phip	T	C	9: 82,915,339	H537R	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpdc1	T	A	13: 48,592,659		probably null	Het
Ptprq	T	C	10: 107,653,493	T924A	probably benign	Het
Pwp2	C	A	10: 78,177,742		probably benign	Het
Slc7a4	G	T	16: 17,573,455		probably null	Het
Tmem132b	T	A	5: 125,638,208	I327K	probably damaging	Het
Trim9	T	C	12: 70,347,159	M4V	probably damaging	Het
Tspan13	T	C	12: 36,021,830	S128G	probably benign	Het
Ttc25	T	A	11: 100,563,582	F398I	possibly damaging	Het
Zbtb20	A	G	16: 43,609,519	D131G	probably null	Het
Zeb2	A	T	2: 44,997,156	C615S	probably damaging	Het
Zfp777	C	T	6: 48,044,242	D149N	probably benign	Het
Zfp990	A	G	4: 145,537,322	K297E	possibly damaging	Het

Other mutations in Msh6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Msh6	APN	17	87985479	missense	probably benign
IGL01834:Msh6	APN	17	87985712	missense	probably damaging	1.00
IGL01904:Msh6	APN	17	87984732	missense	probably benign
IGL01957:Msh6	APN	17	87985091	missense	possibly damaging	0.73
IGL02117:Msh6	APN	17	87990806	unclassified	probably benign
IGL02234:Msh6	APN	17	87986801	missense	probably damaging	1.00
IGL02512:Msh6	APN	17	87984732	missense	probably benign
IGL02651:Msh6	APN	17	87989515	missense	probably damaging	1.00
IGL03381:Msh6	APN	17	87985109	missense	probably damaging	1.00
medea	UTSW	17	87980223	nonsense	probably null
medusa	UTSW	17	87988463	unclassified	probably benign
PIT4449001:Msh6	UTSW	17	87986188	missense	probably damaging	0.96
R0196:Msh6	UTSW	17	87980360	missense	possibly damaging	0.95
R0324:Msh6	UTSW	17	87986620	nonsense	probably null
R0492:Msh6	UTSW	17	87975251	missense	probably benign
R0711:Msh6	UTSW	17	87986684	missense	probably damaging	1.00
R1065:Msh6	UTSW	17	87988463	unclassified	probably benign
R1454:Msh6	UTSW	17	87984758	missense	probably benign	0.00
R1740:Msh6	UTSW	17	87985722	missense	possibly damaging	0.72
R1770:Msh6	UTSW	17	87980223	nonsense	probably null
R1771:Msh6	UTSW	17	87984522	missense	probably benign	0.17
R1919:Msh6	UTSW	17	87985125	missense	probably benign	0.01
R1926:Msh6	UTSW	17	87986225	missense	probably benign
R2026:Msh6	UTSW	17	87990343	missense	probably damaging	1.00
R2095:Msh6	UTSW	17	87988233	missense	possibly damaging	0.93
R2149:Msh6	UTSW	17	87986088	missense	probably damaging	1.00
R2156:Msh6	UTSW	17	87986140	nonsense	probably null
R2167:Msh6	UTSW	17	87989483	missense	probably damaging	1.00
R2382:Msh6	UTSW	17	87984731	missense	probably benign
R3005:Msh6	UTSW	17	87988285	missense	probably benign	0.34
R3160:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	87985481	missense	probably damaging	1.00
R3774:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R3775:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
R4350:Msh6	UTSW	17	87984584	missense	probably damaging	1.00
R4424:Msh6	UTSW	17	87990789	nonsense	probably null
R4499:Msh6	UTSW	17	87980269	missense	probably damaging	1.00
R4667:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4668:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4669:Msh6	UTSW	17	87984806	missense	possibly damaging	0.89
R4849:Msh6	UTSW	17	87983519	missense	possibly damaging	0.94
R5137:Msh6	UTSW	17	87980288	missense	possibly damaging	0.83
R5472:Msh6	UTSW	17	87984561	missense	possibly damaging	0.81
R5594:Msh6	UTSW	17	87986069	missense	probably benign	0.00
R5607:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5608:Msh6	UTSW	17	87986901	missense	probably damaging	1.00
R5660:Msh6	UTSW	17	87984719	missense	possibly damaging	0.94
R6243:Msh6	UTSW	17	87983571	missense	possibly damaging	0.69
R6279:Msh6	UTSW	17	87980249	missense	probably damaging	1.00
R6357:Msh6	UTSW	17	87984460	nonsense	probably null
R6399:Msh6	UTSW	17	87986891	missense	probably damaging	1.00
R6453:Msh6	UTSW	17	87985739	missense	probably damaging	1.00
R6646:Msh6	UTSW	17	87986442	missense	possibly damaging	0.80
R7404:Msh6	UTSW	17	87975120
R7837:Msh6	UTSW	17	87984666	missense	probably damaging	1.00
R8004:Msh6	UTSW	17	87986787	missense	probably damaging	1.00
R8296:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8326:Msh6	UTSW	17	87986912	missense	probably damaging	1.00
R8377:Msh6	UTSW	17	87985170	missense	probably damaging	1.00
R8715:Msh6	UTSW	17	87985767	missense	probably benign
R9752:Msh6	UTSW	17	87986535	missense	probably damaging	1.00
X0026:Msh6	UTSW	17	87986181	missense	probably damaging	1.00
X0026:Msh6	UTSW	17	87990614	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCGGATTCCTTGGTGCAG -3'
(R):5'- CTGTTGAGAGATTTCCTTTCTCGAAC -3'

Sequencing Primer
(F):5'- ATTCCTTGGTGCAGAAGGGCTATAAG -3'
(R):5'- CTCGAACAAAATTTGTACTGGAGG -3'

Posted On

2014-09-18