Incidental Mutation 'R2097:Pggt1b'
ID 230342
Institutional Source Beutler Lab
Gene Symbol Pggt1b
Ensembl Gene ENSMUSG00000024477
Gene Name protein geranylgeranyltransferase type I, beta subunit
Synonyms BGG1, GGT1, 2010207C17Rik
MMRRC Submission 040101-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R2097 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 46368418-46414060 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46379695 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 296 (N296D)
Ref Sequence ENSEMBL: ENSMUSP00000025354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025354]
AlphaFold Q8BUY9
Predicted Effect probably benign
Transcript: ENSMUST00000025354
AA Change: N296D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025354
Gene: ENSMUSG00000024477
AA Change: N296D

DomainStartEndE-ValueType
Pfam:Prenyltrans 142 186 8.6e-10 PFAM
Pfam:Prenyltrans 191 234 2.2e-10 PFAM
Pfam:Prenyltrans 240 284 4.8e-10 PFAM
Pfam:Prenyltrans 289 333 4e-12 PFAM
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein geranylgeranyltransferase type I (GGTase-I) transfers a geranylgeranyl group to the cysteine residue of candidate proteins containing a C-terminal CAAX motif in which 'A' is an aliphatic amino acid and 'X' is leucine (summarized by Zhang et al., 1994 [PubMed 8106351]). The enzyme is composed of a 48-kD alpha subunit (FNTA; MIM 134635) and a 43-kD beta subunit, encoded by the PGGT1B gene. The FNTA gene encodes the alpha subunit for both GGTase-I and the related enzyme farnesyltransferase.[supplied by OMIM, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene blocks proliferation of primary mouse fibroblasts, disrupts the actin cytoskeleton, and results in altered cell morphology and reduced cell migration in a standard wound healing assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,709,185 (GRCm39) V263A probably damaging Het
Apol6 T A 15: 76,931,333 (GRCm39) probably null Het
Aqp3 C T 4: 41,098,004 (GRCm39) V36M possibly damaging Het
Bace1 G T 9: 45,771,520 (GRCm39) C478F probably benign Het
Bbof1 C A 12: 84,460,081 (GRCm39) A116D probably damaging Het
Casq1 A T 1: 172,037,988 (GRCm39) L381Q probably damaging Het
Ccdc138 T A 10: 58,397,759 (GRCm39) L533* probably null Het
Cdcp3 A T 7: 130,783,693 (GRCm39) R29* probably null Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Cntn6 A G 6: 104,838,910 (GRCm39) E988G probably damaging Het
Cts6 T A 13: 61,343,259 (GRCm39) N321Y probably damaging Het
Dnmt1 A G 9: 20,821,084 (GRCm39) S1269P probably benign Het
Dsg4 C A 18: 20,604,101 (GRCm39) P856H probably damaging Het
Fndc3a C A 14: 72,811,791 (GRCm39) probably null Het
Galc T C 12: 98,218,291 (GRCm39) D187G probably benign Het
Gfm1 T C 3: 67,357,079 (GRCm39) I384T probably damaging Het
Hacd2 A G 16: 34,869,090 (GRCm39) I92V probably benign Het
Hmcn2 T A 2: 31,270,431 (GRCm39) Y1223N probably damaging Het
Il20ra T C 10: 19,635,211 (GRCm39) I484T probably damaging Het
Map7 G T 10: 20,122,362 (GRCm39) V143F probably damaging Het
Mcm3ap T C 10: 76,348,323 (GRCm39) L1893P probably damaging Het
Msh6 A G 17: 88,292,844 (GRCm39) N533S probably benign Het
Nbea T C 3: 55,630,638 (GRCm39) D2233G probably damaging Het
Nlrp6 A T 7: 140,503,117 (GRCm39) T408S probably damaging Het
Notch3 A T 17: 32,341,728 (GRCm39) L2008Q probably damaging Het
Odad4 T A 11: 100,454,408 (GRCm39) F398I possibly damaging Het
Or52e19b T A 7: 103,032,840 (GRCm39) D123V probably damaging Het
Or8k20 A T 2: 86,106,383 (GRCm39) Y149* probably null Het
Pglyrp3 T A 3: 91,935,478 (GRCm39) F243I possibly damaging Het
Phip T C 9: 82,797,392 (GRCm39) H537R possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpdc1 T A 13: 48,746,135 (GRCm39) probably null Het
Ptprq T C 10: 107,489,354 (GRCm39) T924A probably benign Het
Pwp2 C A 10: 78,013,576 (GRCm39) probably benign Het
Slc7a4 G T 16: 17,391,319 (GRCm39) probably null Het
Tmem132b T A 5: 125,715,272 (GRCm39) I327K probably damaging Het
Trim9 T C 12: 70,393,933 (GRCm39) M4V probably damaging Het
Tspan13 T C 12: 36,071,829 (GRCm39) S128G probably benign Het
Zbtb20 A G 16: 43,429,882 (GRCm39) D131G probably null Het
Zeb2 A T 2: 44,887,168 (GRCm39) C615S probably damaging Het
Zfp777 C T 6: 48,021,176 (GRCm39) D149N probably benign Het
Zfp990 A G 4: 145,263,892 (GRCm39) K297E possibly damaging Het
Other mutations in Pggt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pggt1b APN 18 46,413,786 (GRCm39) missense probably benign 0.06
IGL02012:Pggt1b APN 18 46,396,022 (GRCm39) missense probably benign
P0035:Pggt1b UTSW 18 46,392,787 (GRCm39) missense probably damaging 1.00
R0140:Pggt1b UTSW 18 46,391,150 (GRCm39) critical splice donor site probably null
R0448:Pggt1b UTSW 18 46,396,039 (GRCm39) splice site probably benign
R4010:Pggt1b UTSW 18 46,382,003 (GRCm39) missense possibly damaging 0.93
R4839:Pggt1b UTSW 18 46,391,166 (GRCm39) missense possibly damaging 0.50
R5947:Pggt1b UTSW 18 46,382,007 (GRCm39) missense probably benign 0.25
R6225:Pggt1b UTSW 18 46,407,674 (GRCm39) missense possibly damaging 0.48
R9781:Pggt1b UTSW 18 46,392,779 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACCTTAAACCTGTCGCAAACAATG -3'
(R):5'- TTTAAGTGCTCAAGTCTCCAGAG -3'

Sequencing Primer
(F):5'- GCACATTTAGAGGTCAAAGGTTCTCC -3'
(R):5'- AGATTTGCTCTGAGAGTCTAAGC -3'
Posted On 2014-09-18