Incidental Mutation 'R2098:Cd84'
ID230347
Institutional Source Beutler Lab
Gene Symbol Cd84
Ensembl Gene ENSMUSG00000038147
Gene NameCD84 antigen
SynonymsCDw84, A130013D22Rik, SLAMF5
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2098 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171839697-171890718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 171885581 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 291 (C291Y)
Ref Sequence ENSEMBL: ENSMUSP00000120881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042302] [ENSMUST00000136479] [ENSMUST00000155802]
Predicted Effect probably benign
Transcript: ENSMUST00000042302
AA Change: C291Y

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047024
Gene: ENSMUSG00000038147
AA Change: C291Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136479
AA Change: C290Y

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147
AA Change: C290Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155802
AA Change: C291Y

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120881
Gene: ENSMUSG00000038147
AA Change: C291Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of this gene show defects in T follicular helper function and germinal center formation. Mice homozygous for a different knock-out allele display normal platelet physiology and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Cd84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cd84 APN 1 171852137 critical splice donor site probably null
IGL01371:Cd84 APN 1 171886370 missense probably benign 0.36
IGL03035:Cd84 APN 1 171852034 missense probably damaging 0.99
IGL03098:Cd84 APN 1 171872700 missense possibly damaging 0.78
R0511:Cd84 UTSW 1 171872927 missense probably benign 0.00
R1244:Cd84 UTSW 1 171851830 missense probably damaging 0.99
R1438:Cd84 UTSW 1 171852118 missense probably damaging 1.00
R1459:Cd84 UTSW 1 171851943 missense probably benign 0.02
R1654:Cd84 UTSW 1 171884606 missense possibly damaging 0.69
R1658:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1659:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1765:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1771:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1776:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1799:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1815:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1816:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1982:Cd84 UTSW 1 171884585 splice site probably null
R1990:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2056:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2057:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2058:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R4674:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4675:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4806:Cd84 UTSW 1 171852121 missense probably benign 0.00
R4828:Cd84 UTSW 1 171872748 missense probably damaging 0.97
R4908:Cd84 UTSW 1 171872865 missense probably damaging 0.96
R5366:Cd84 UTSW 1 171873305 missense probably damaging 1.00
R5725:Cd84 UTSW 1 171873361 missense probably benign 0.00
R5883:Cd84 UTSW 1 171872838 missense possibly damaging 0.58
R6722:Cd84 UTSW 1 171872777 missense probably damaging 0.98
R6966:Cd84 UTSW 1 171886409 missense possibly damaging 0.93
R7513:Cd84 UTSW 1 171884618 missense probably benign 0.01
R7733:Cd84 UTSW 1 171840659 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAGGCCTTTTGCTACAAAG -3'
(R):5'- ACTTTCCCATTGGCTCGAGG -3'

Sequencing Primer
(F):5'- CATTACCTTAGCCTAATCCAAAGTTG -3'
(R):5'- CCATTGGCTCGAGGAGACTTG -3'
Posted On2014-09-18