Incidental Mutation 'R2098:Mllt10'
ID230348
Institutional Source Beutler Lab
Gene Symbol Mllt10
Ensembl Gene ENSMUSG00000026743
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
SynonymsAf10, D630001B22Rik, B130021D15Rik
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R2098 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18055237-18212388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18162653 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 385 (V385A)
Ref Sequence ENSEMBL: ENSMUSP00000110319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028076] [ENSMUST00000114669] [ENSMUST00000114671] [ENSMUST00000114680]
Predicted Effect probably benign
Transcript: ENSMUST00000028076
AA Change: V463A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028076
Gene: ENSMUSG00000026743
AA Change: V463A

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083030
Predicted Effect probably benign
Transcript: ENSMUST00000114669
SMART Domains Protein: ENSMUSP00000110317
Gene: ENSMUSG00000026743

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
coiled coil region 198 239 N/A INTRINSIC
low complexity region 293 336 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114671
AA Change: V385A

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110319
Gene: ENSMUSG00000026743
AA Change: V385A

DomainStartEndE-ValueType
PHD 58 117 2.92e-6 SMART
low complexity region 139 170 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 412 437 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
low complexity region 531 549 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
coiled coil region 663 704 N/A INTRINSIC
low complexity region 758 801 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
low complexity region 888 908 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114680
AA Change: V463A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110328
Gene: ENSMUSG00000026743
AA Change: V463A

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148229
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Mllt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Mllt10 APN 2 18122317 missense probably damaging 1.00
IGL02366:Mllt10 APN 2 18065087 missense probably damaging 0.99
IGL02990:Mllt10 APN 2 18123711 splice site probably benign
IGL03034:Mllt10 APN 2 18065036 start codon destroyed probably null 0.55
R0348:Mllt10 UTSW 2 18162613 missense probably damaging 1.00
R0487:Mllt10 UTSW 2 18207137 missense probably damaging 0.98
R0492:Mllt10 UTSW 2 18146887 splice site probably benign
R0518:Mllt10 UTSW 2 18071206 critical splice donor site probably null
R0720:Mllt10 UTSW 2 18196595 missense probably benign
R0733:Mllt10 UTSW 2 18203766 intron probably benign
R1532:Mllt10 UTSW 2 18092835 critical splice donor site probably null
R1665:Mllt10 UTSW 2 18208790 missense possibly damaging 0.93
R1768:Mllt10 UTSW 2 18162846 missense probably damaging 1.00
R2114:Mllt10 UTSW 2 18162569 missense probably benign
R2116:Mllt10 UTSW 2 18162569 missense probably benign
R2117:Mllt10 UTSW 2 18162569 missense probably benign
R2179:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R2192:Mllt10 UTSW 2 18207060 missense probably benign 0.11
R2510:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R2511:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R4669:Mllt10 UTSW 2 18203633 missense probably damaging 1.00
R5004:Mllt10 UTSW 2 18170268 missense probably damaging 1.00
R5072:Mllt10 UTSW 2 18109874 missense possibly damaging 0.72
R5187:Mllt10 UTSW 2 18208774 nonsense probably null
R5561:Mllt10 UTSW 2 18109845 missense probably damaging 0.98
R6141:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R6352:Mllt10 UTSW 2 18123793 missense probably damaging 1.00
R6844:Mllt10 UTSW 2 18159483 missense probably benign 0.02
R7060:Mllt10 UTSW 2 18159560 missense possibly damaging 0.64
R7464:Mllt10 UTSW 2 18170279 missense probably benign
R7691:Mllt10 UTSW 2 18203611 missense possibly damaging 0.94
R7691:Mllt10 UTSW 2 18203612 missense probably null 0.94
R7937:Mllt10 UTSW 2 18206084 missense probably damaging 1.00
R7956:Mllt10 UTSW 2 18170257 missense probably benign 0.01
R7976:Mllt10 UTSW 2 18162403 missense possibly damaging 0.94
R8079:Mllt10 UTSW 2 18123756 missense probably damaging 0.99
R8084:Mllt10 UTSW 2 18109826 missense probably damaging 0.99
R8518:Mllt10 UTSW 2 18146859 missense probably damaging 0.99
Z1177:Mllt10 UTSW 2 18171076 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCGAAGTGACAGTTACACTCAC -3'
(R):5'- ATTCCTGAGCAGCGTAGGAG -3'

Sequencing Primer
(F):5'- GTGACAGTTACACTCACACCCAG -3'
(R):5'- CCTGAGCAGCGTAGGAGATTTC -3'
Posted On2014-09-18