Incidental Mutation 'R2098:Olfr1136'
ID230351
Institutional Source Beutler Lab
Gene Symbol Olfr1136
Ensembl Gene ENSMUSG00000075151
Gene Nameolfactory receptor 1136
SynonymsMOR177-3, GA_x6K02T2Q125-49193051-49192119
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R2098 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87692881-87693947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87693729 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 51 (M51K)
Ref Sequence ENSEMBL: ENSMUSP00000076681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471] [ENSMUST00000099852]
Predicted Effect probably benign
Transcript: ENSMUST00000077471
AA Change: M51K

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: M51K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099852
AA Change: M51K

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097438
Gene: ENSMUSG00000068815
AA Change: M51K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-41 PFAM
Pfam:7tm_1 41 290 4.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Olfr1136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01809:Olfr1136 APN 2 87693745 missense possibly damaging 0.73
IGL02190:Olfr1136 APN 2 87693063 missense probably benign 0.21
IGL02902:Olfr1136 APN 2 87693000 missense probably damaging 1.00
PIT4508001:Olfr1136 UTSW 2 87693715 missense probably damaging 1.00
R0153:Olfr1136 UTSW 2 87693604 missense probably benign 0.05
R0665:Olfr1136 UTSW 2 87693808 missense probably benign 0.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1518:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R1812:Olfr1136 UTSW 2 87693103 missense probably benign 0.01
R1993:Olfr1136 UTSW 2 87693433 missense probably benign 0.07
R3106:Olfr1136 UTSW 2 87693505 missense probably damaging 0.98
R4622:Olfr1136 UTSW 2 87693643 nonsense probably null
R4694:Olfr1136 UTSW 2 87693760 missense probably benign 0.03
R5079:Olfr1136 UTSW 2 87693208 missense probably damaging 0.99
R5474:Olfr1136 UTSW 2 87693057 missense probably damaging 1.00
R6432:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R6667:Olfr1136 UTSW 2 87693570 missense probably benign 0.00
R7519:Olfr1136 UTSW 2 87693409 missense probably benign 0.01
R7652:Olfr1136 UTSW 2 87693360 missense probably damaging 1.00
R7657:Olfr1136 UTSW 2 87692992 missense probably damaging 0.99
R8230:Olfr1136 UTSW 2 87693361 missense probably damaging 1.00
R8439:Olfr1136 UTSW 2 87693744 missense probably damaging 1.00
Z1176:Olfr1136 UTSW 2 87693151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTATCTATCAAAGGCCATCACC -3'
(R):5'- ATCAAACCCTAAGAGACCTTTGTC -3'

Sequencing Primer
(F):5'- TCACCGCCAGCAGCATG -3'
(R):5'- CTCATCTGTGCCTGAGTT -3'
Posted On2014-09-18