Incidental Mutation 'R2098:Or4c11'
ID 230352
Institutional Source Beutler Lab
Gene Symbol Or4c11
Ensembl Gene ENSMUSG00000062757
Gene Name olfactory receptor family 4 subfamily C member 11
Synonyms GA_x6K02T2Q125-50339974-50340609, Olfr1207, Olfr1206, MOR230-3, GA_x6K02T2Q125-50338497-50339264
MMRRC Submission 040102-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R2098 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 88694951-88695874 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88695215 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 89 (I89F)
Ref Sequence ENSEMBL: ENSMUSP00000149929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077302] [ENSMUST00000216950]
AlphaFold A2ATJ9
Predicted Effect probably benign
Transcript: ENSMUST00000077302
AA Change: I89F

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076532
Gene: ENSMUSG00000062757
AA Change: I89F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216950
AA Change: I89F

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 109,927,405 (GRCm39) E1316G probably damaging Het
Arhgap32 C A 9: 32,171,207 (GRCm39) T1329K probably damaging Het
Arhgef10l G C 4: 140,306,743 (GRCm39) L104V probably damaging Het
Bend3 T C 10: 43,386,500 (GRCm39) S298P probably damaging Het
Cacna1b C T 2: 24,540,558 (GRCm39) V1385M probably damaging Het
Camk2d G A 3: 126,574,091 (GRCm39) G166D probably damaging Het
Cd84 G A 1: 171,713,148 (GRCm39) C291Y probably benign Het
Cdhr2 A G 13: 54,863,457 (GRCm39) I113V probably benign Het
Cfap206 G A 4: 34,719,053 (GRCm39) Q318* probably null Het
Chd9 C T 8: 91,760,615 (GRCm39) P2120L probably benign Het
Cyth1 T A 11: 118,084,479 (GRCm39) I25F probably damaging Het
Dock2 A G 11: 34,609,832 (GRCm39) S203P probably damaging Het
Dock2 A T 11: 34,216,279 (GRCm39) N1208K probably benign Het
Ehbp1l1 G T 19: 5,758,686 (GRCm39) T1652K possibly damaging Het
Eps8l2 G A 7: 140,935,705 (GRCm39) probably null Het
Fam3d T C 14: 8,361,479 (GRCm38) I47V probably benign Het
Gm10250 A G 15: 5,150,296 (GRCm39) probably benign Het
Gm9772 T C 17: 22,225,618 (GRCm39) H94R probably benign Het
Hspg2 G A 4: 137,247,420 (GRCm39) G1184D probably damaging Het
Igfn1 T A 1: 135,906,043 (GRCm39) D255V probably damaging Het
Marf1 T C 16: 13,932,064 (GRCm39) H1651R probably benign Het
Mllt10 T C 2: 18,167,464 (GRCm39) V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 (GRCm39) S76L probably benign Het
Mrps2 C A 2: 28,358,327 (GRCm39) T39K probably benign Het
Myo6 T C 9: 80,188,808 (GRCm39) Y715H probably damaging Het
Nsun7 A G 5: 66,441,055 (GRCm39) E392G probably damaging Het
Obscn C T 11: 58,960,817 (GRCm39) E3374K probably damaging Het
Or2a20 G A 6: 43,194,437 (GRCm39) V197I probably benign Het
Or56a4 A G 7: 104,806,478 (GRCm39) V137A probably benign Het
Or5w13 A T 2: 87,524,073 (GRCm39) M51K probably benign Het
Pkd2 C T 5: 104,626,768 (GRCm39) P317S probably damaging Het
Prl5a1 T C 13: 28,329,488 (GRCm39) S56P probably damaging Het
Psmd1 A G 1: 86,009,823 (GRCm39) probably null Het
Ptchd3 T C 11: 121,733,305 (GRCm39) C732R probably damaging Het
Rad51c A T 11: 87,293,589 (GRCm39) V71E probably benign Het
Scn11a A T 9: 119,621,560 (GRCm39) I619K possibly damaging Het
Sgpp1 T G 12: 75,763,284 (GRCm39) D299A probably damaging Het
Slc16a4 C A 3: 107,208,163 (GRCm39) Y224* probably null Het
Slc22a30 G A 19: 8,378,175 (GRCm39) S167L probably damaging Het
Slc6a5 T C 7: 49,595,315 (GRCm39) I559T probably damaging Het
Spire1 A G 18: 67,636,536 (GRCm39) F364L probably damaging Het
Srek1 G A 13: 103,881,363 (GRCm39) T421I unknown Het
St8sia4 T C 1: 95,581,253 (GRCm39) H163R probably damaging Het
Supt6 A G 11: 78,104,087 (GRCm39) probably null Het
Tas2r103 T C 6: 133,013,560 (GRCm39) T169A probably benign Het
Thrap3 A G 4: 126,073,823 (GRCm39) S308P probably damaging Het
V1rd19 C T 7: 23,703,160 (GRCm39) L209F probably damaging Het
Zfp267 T A 3: 36,220,289 (GRCm39) S771T probably benign Het
Other mutations in Or4c11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Or4c11 APN 2 88,695,864 (GRCm39) missense probably benign 0.00
IGL01415:Or4c11 APN 2 88,695,864 (GRCm39) missense probably benign 0.00
IGL01783:Or4c11 APN 2 88,695,186 (GRCm39) missense probably damaging 0.98
PIT4812001:Or4c11 UTSW 2 88,695,314 (GRCm39) missense probably benign 0.27
R0437:Or4c11 UTSW 2 88,695,229 (GRCm39) missense probably benign 0.01
R0561:Or4c11 UTSW 2 88,695,024 (GRCm39) missense possibly damaging 0.68
R0669:Or4c11 UTSW 2 88,695,272 (GRCm39) missense probably benign
R0835:Or4c11 UTSW 2 88,695,345 (GRCm39) missense probably benign
R0987:Or4c11 UTSW 2 88,695,527 (GRCm39) missense probably benign 0.00
R1271:Or4c11 UTSW 2 88,695,475 (GRCm39) nonsense probably null
R1386:Or4c11 UTSW 2 88,695,697 (GRCm39) missense probably benign 0.14
R1618:Or4c11 UTSW 2 88,695,871 (GRCm39) splice site probably null
R1935:Or4c11 UTSW 2 88,695,524 (GRCm39) missense probably benign
R2112:Or4c11 UTSW 2 88,695,545 (GRCm39) missense possibly damaging 0.67
R2157:Or4c11 UTSW 2 88,695,213 (GRCm39) missense probably benign
R2912:Or4c11 UTSW 2 88,695,458 (GRCm39) missense probably benign 0.17
R2913:Or4c11 UTSW 2 88,695,458 (GRCm39) missense probably benign 0.17
R4583:Or4c11 UTSW 2 88,695,838 (GRCm39) missense probably benign 0.07
R4631:Or4c11 UTSW 2 88,695,174 (GRCm39) missense probably benign 0.00
R7707:Or4c11 UTSW 2 88,695,153 (GRCm39) missense possibly damaging 0.78
R8559:Or4c11 UTSW 2 88,695,527 (GRCm39) missense probably benign 0.00
R9163:Or4c11 UTSW 2 88,695,795 (GRCm39) missense possibly damaging 0.63
R9164:Or4c11 UTSW 2 88,695,795 (GRCm39) missense possibly damaging 0.63
R9468:Or4c11 UTSW 2 88,695,795 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GATCCCCTGAAGCAGAAAATGG -3'
(R):5'- GCCAAAACAATCTGAGCAGTG -3'

Sequencing Primer
(F):5'- ATCTTCTTAGTTTTCTATTTGGGGAC -3'
(R):5'- GTGGAATGTATAAAAGACCCTATCC -3'
Posted On 2014-09-18