Incidental Mutation 'R2098:D3Ertd254e'
ID230354
Institutional Source Beutler Lab
Gene Symbol D3Ertd254e
Ensembl Gene ENSMUSG00000033883
Gene NameDNA segment, Chr 3, ERATO Doi 254, expressed
Synonyms
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R2098 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36151017-36170342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36166140 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 771 (S771T)
Ref Sequence ENSEMBL: ENSMUSP00000142829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165956] [ENSMUST00000197653] [ENSMUST00000205077]
Predicted Effect probably benign
Transcript: ENSMUST00000165956
AA Change: S770T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131779
Gene: ENSMUSG00000033883
AA Change: S770T

DomainStartEndE-ValueType
KRAB 3 63 2.91e-34 SMART
ZnF_C2H2 342 364 1.08e-1 SMART
ZnF_C2H2 395 417 1.56e-2 SMART
ZnF_C2H2 423 445 3.11e-2 SMART
ZnF_C2H2 451 473 5.9e-3 SMART
ZnF_C2H2 479 501 1.82e-3 SMART
ZnF_C2H2 507 529 5.21e-4 SMART
ZnF_C2H2 535 557 1.84e-4 SMART
ZnF_C2H2 563 585 1.95e-3 SMART
ZnF_C2H2 591 613 2.05e-2 SMART
ZnF_C2H2 619 641 1.6e-4 SMART
ZnF_C2H2 647 669 5.21e-4 SMART
ZnF_C2H2 675 697 1.69e-3 SMART
ZnF_C2H2 703 725 2.61e-4 SMART
ZnF_C2H2 731 753 1.12e-3 SMART
ZnF_C2H2 759 779 3.85e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197653
AA Change: S771T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142829
Gene: ENSMUSG00000033883
AA Change: S771T

DomainStartEndE-ValueType
KRAB 4 64 1.2e-36 SMART
ZnF_C2H2 343 365 4.4e-4 SMART
ZnF_C2H2 396 418 6.7e-5 SMART
ZnF_C2H2 424 446 1.3e-4 SMART
ZnF_C2H2 452 474 2.5e-5 SMART
ZnF_C2H2 480 502 7.9e-6 SMART
ZnF_C2H2 508 530 2.2e-6 SMART
ZnF_C2H2 536 558 7.7e-7 SMART
ZnF_C2H2 564 586 8e-6 SMART
ZnF_C2H2 592 614 8.9e-5 SMART
ZnF_C2H2 620 642 6.6e-7 SMART
ZnF_C2H2 648 670 2.2e-6 SMART
ZnF_C2H2 676 698 7.1e-6 SMART
ZnF_C2H2 704 726 1.1e-6 SMART
ZnF_C2H2 732 754 4.8e-6 SMART
ZnF_C2H2 760 780 1.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205077
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in D3Ertd254e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:D3Ertd254e APN 3 36164580 missense possibly damaging 0.86
IGL02089:D3Ertd254e APN 3 36164728 missense possibly damaging 0.53
IGL02162:D3Ertd254e APN 3 36164061 missense probably benign 0.18
R0243:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R0512:D3Ertd254e UTSW 3 36166113 missense probably damaging 0.96
R0722:D3Ertd254e UTSW 3 36165069 missense probably benign 0.35
R0762:D3Ertd254e UTSW 3 36165867 missense possibly damaging 0.92
R0792:D3Ertd254e UTSW 3 36164562 missense probably benign 0.01
R0894:D3Ertd254e UTSW 3 36164786 nonsense probably null
R1731:D3Ertd254e UTSW 3 36164471 missense probably benign 0.18
R2099:D3Ertd254e UTSW 3 36164212 missense possibly damaging 0.86
R3709:D3Ertd254e UTSW 3 36159576 missense possibly damaging 0.71
R3808:D3Ertd254e UTSW 3 36165643 splice site probably null
R4035:D3Ertd254e UTSW 3 36164840 missense possibly damaging 0.53
R4288:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4289:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4959:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R4973:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R5102:D3Ertd254e UTSW 3 36162665 missense possibly damaging 0.73
R5462:D3Ertd254e UTSW 3 36165820 missense possibly damaging 0.95
R5548:D3Ertd254e UTSW 3 36165491 missense possibly damaging 0.90
R5782:D3Ertd254e UTSW 3 36164979 missense possibly damaging 0.73
R6153:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R6225:D3Ertd254e UTSW 3 36166203 missense probably benign 0.18
R6602:D3Ertd254e UTSW 3 36164855 missense possibly damaging 0.86
R6785:D3Ertd254e UTSW 3 36165452 nonsense probably null
R7513:D3Ertd254e UTSW 3 36164643 missense possibly damaging 0.53
R7846:D3Ertd254e UTSW 3 36165589 missense probably benign 0.43
R8120:D3Ertd254e UTSW 3 36164491 missense possibly damaging 0.96
R8265:D3Ertd254e UTSW 3 36159528 start gained probably benign
R8415:D3Ertd254e UTSW 3 36165033 missense probably damaging 0.98
X0021:D3Ertd254e UTSW 3 36164191 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CAAGATTGTGGCAGAGCGTTTAATC -3'
(R):5'- AGGATATGGCTCCGGAAATCC -3'

Sequencing Primer
(F):5'- GCGTTTAATCAAAGGTCAAGCC -3'
(R):5'- CTCCGGAAATCCAGTTAGGTATTGC -3'
Posted On2014-09-18