Incidental Mutation 'R2098:Camk2d'
ID230356
Institutional Source Beutler Lab
Gene Symbol Camk2d
Ensembl Gene ENSMUSG00000053819
Gene Namecalcium/calmodulin-dependent protein kinase II, delta
SynonymsCaMK II, 2810011D23Rik, 8030469K03Rik
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R2098 (G1)
Quality Score172
Status Not validated
Chromosome3
Chromosomal Location126596302-126846326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126780442 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 166 (G166D)
Ref Sequence ENSEMBL: ENSMUSP00000133019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066466] [ENSMUST00000106399] [ENSMUST00000106400] [ENSMUST00000106401] [ENSMUST00000106402] [ENSMUST00000134466] [ENSMUST00000145454] [ENSMUST00000163226] [ENSMUST00000171289] [ENSMUST00000199300] [ENSMUST00000200171]
Predicted Effect probably damaging
Transcript: ENSMUST00000066466
AA Change: G166D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063359
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 7.4e-67 PFAM
Pfam:DUF4440 350 464 4.7e-13 PFAM
Pfam:SnoaL_3 350 476 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106399
AA Change: G166D

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102007
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 357 484 3.5e-67 PFAM
Pfam:DUF4440 361 475 5.4e-13 PFAM
Pfam:SnoaL_3 361 487 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106400
AA Change: G166D

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102008
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 4.7e-67 PFAM
Pfam:DUF4440 350 464 3.2e-13 PFAM
Pfam:SnoaL_3 350 476 2.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106401
AA Change: G166D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102009
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.8e-67 PFAM
Pfam:DUF4440 384 498 5.8e-13 PFAM
Pfam:SnoaL_3 384 510 3.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106402
AA Change: G166D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102010
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 1.1e-66 PFAM
Pfam:DUF4440 384 498 8.1e-13 PFAM
Pfam:SnoaL_3 384 510 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131869
SMART Domains Protein: ENSMUSP00000126412
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 1 109 5.1e-26 PFAM
Pfam:Pkinase_Tyr 3 111 4.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134466
SMART Domains Protein: ENSMUSP00000114801
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1e-33 PFAM
Pfam:Pkinase_Tyr 14 141 4.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134987
Predicted Effect probably benign
Transcript: ENSMUST00000145454
SMART Domains Protein: ENSMUSP00000130769
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1.4e-33 PFAM
Pfam:Pkinase_Tyr 14 142 4.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147043
Predicted Effect probably damaging
Transcript: ENSMUST00000163226
AA Change: G166D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133019
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169051
SMART Domains Protein: ENSMUSP00000132554
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 6.9e-67 PFAM
Pfam:DUF4440 350 464 4.3e-13 PFAM
Pfam:SnoaL_3 350 476 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171289
AA Change: G166D

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129999
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.3e-63 PFAM
Pfam:DUF4440 384 498 3.2e-12 PFAM
Pfam:SnoaL_3 384 509 8.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199300
AA Change: G166D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143504
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 1.3e-62 PFAM
Pfam:DUF4440 350 464 1.7e-11 PFAM
Pfam:SnoaL_3 350 475 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200171
AA Change: G166D

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143677
Gene: ENSMUSG00000053819
AA Change: G166D

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 9.8e-63 PFAM
Pfam:DUF4440 384 498 2.5e-11 PFAM
Pfam:SnoaL_3 384 509 5.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171950
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced response to heart induced stress. Mice homozygous for an allele that produces an oxidant-resistant product exhibit reduced response to myocardial infarction in a diabetic model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Camk2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Camk2d APN 3 126838272 nonsense probably null
IGL01113:Camk2d APN 3 126780412 missense probably damaging 1.00
IGL01125:Camk2d APN 3 126798285 splice site probably benign
IGL01912:Camk2d APN 3 126810632 splice site probably null
IGL01934:Camk2d APN 3 126834655 splice site probably null
IGL02184:Camk2d APN 3 126797773 missense probably damaging 0.97
IGL02218:Camk2d APN 3 126840153 missense probably benign 0.00
IGL02804:Camk2d APN 3 126797738 missense possibly damaging 0.53
IGL03347:Camk2d APN 3 126796901 missense probably damaging 1.00
IGL03354:Camk2d APN 3 126796966 splice site probably null
baryon UTSW 3 126597482 nonsense probably null
neutron UTSW 3 126780420 missense probably damaging 1.00
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0628:Camk2d UTSW 3 126810624 splice site probably benign
R1114:Camk2d UTSW 3 126840292 missense probably damaging 1.00
R1433:Camk2d UTSW 3 126808224 missense probably benign 0.25
R2021:Camk2d UTSW 3 126780456 missense probably damaging 1.00
R2096:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2421:Camk2d UTSW 3 126780415 missense probably damaging 1.00
R2437:Camk2d UTSW 3 126834628 missense probably damaging 1.00
R2930:Camk2d UTSW 3 126808231 missense possibly damaging 0.86
R3738:Camk2d UTSW 3 126771839 missense probably damaging 1.00
R3969:Camk2d UTSW 3 126796959 missense possibly damaging 0.81
R4455:Camk2d UTSW 3 126780403 missense probably damaging 1.00
R4829:Camk2d UTSW 3 126779997 intron probably benign
R4916:Camk2d UTSW 3 126783975 missense probably damaging 1.00
R5277:Camk2d UTSW 3 126684741 intron probably benign
R5329:Camk2d UTSW 3 126597482 nonsense probably null
R5364:Camk2d UTSW 3 126780420 missense probably damaging 1.00
R5473:Camk2d UTSW 3 126597399 utr 5 prime probably benign
R5509:Camk2d UTSW 3 126840316 missense probably damaging 1.00
R5958:Camk2d UTSW 3 126779865 intron probably benign
R6010:Camk2d UTSW 3 126797714 missense possibly damaging 0.83
R6145:Camk2d UTSW 3 126805858 missense probably benign
R7267:Camk2d UTSW 3 126797730 missense possibly damaging 0.59
R7708:Camk2d UTSW 3 126597440 start codon destroyed probably benign 0.00
R8249:Camk2d UTSW 3 126797729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCATGAGTTTGCTTCCC -3'
(R):5'- ACCAATTTAAGATGGGATCCAGTG -3'

Sequencing Primer
(F):5'- CTGCCCTGTTTAATCTTGTACAAATG -3'
(R):5'- GATGGGATCCAGTGTGTTAAAATTAG -3'
Posted On2014-09-18