Incidental Mutation 'R2098:Nsun7'
ID230361
Institutional Source Beutler Lab
Gene Symbol Nsun7
Ensembl Gene ENSMUSG00000029206
Gene NameNOL1/NOP2/Sun domain family, member 7
Synonyms4921525L17Rik
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2098 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location66259897-66298026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66283712 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 392 (E392G)
Ref Sequence ENSEMBL: ENSMUSP00000031109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031109] [ENSMUST00000201100] [ENSMUST00000202994]
Predicted Effect probably damaging
Transcript: ENSMUST00000031109
AA Change: E392G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031109
Gene: ENSMUSG00000029206
AA Change: E392G

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 394 477 4.2e-7 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113720
AA Change: E392G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109349
Gene: ENSMUSG00000029206
AA Change: E392G

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 312 479 4.4e-9 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201100
AA Change: E392G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144520
Gene: ENSMUSG00000029206
AA Change: E392G

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 312 479 4.3e-9 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202994
AA Change: E392G

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144498
Gene: ENSMUSG00000029206
AA Change: E392G

DomainStartEndE-ValueType
PDB:2B9E|A 205 479 5e-17 PDB
low complexity region 509 521 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOL1/NOP2/sun domain RNA methyltransferase family. Mice with a mutation in this gene exhibit male sterility due to impaired sperm motility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Males homozygous for an ENU-induced mutation are either infertile or subfertile. Mutant sperm exhibit poor progressive motility linked to rigidity of the flagellar midpiece and abnormal electron density patterns in the mitochondrial sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Nsun7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Nsun7 APN 5 66289503 missense probably benign 0.00
IGL01013:Nsun7 APN 5 66283601 missense possibly damaging 0.87
IGL01355:Nsun7 APN 5 66294868 missense probably damaging 1.00
IGL01768:Nsun7 APN 5 66278700 missense probably benign 0.11
IGL01914:Nsun7 APN 5 66276634 missense probably damaging 1.00
IGL01990:Nsun7 APN 5 66261073 missense probably damaging 1.00
IGL02477:Nsun7 APN 5 66276649 missense probably damaging 0.99
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0079:Nsun7 UTSW 5 66295513 missense probably benign 0.00
R0255:Nsun7 UTSW 5 66289408 splice site probably benign
R0503:Nsun7 UTSW 5 66283581 splice site probably benign
R0540:Nsun7 UTSW 5 66283634 missense probably damaging 0.98
R1416:Nsun7 UTSW 5 66261080 missense probably damaging 0.98
R1471:Nsun7 UTSW 5 66284229 missense probably benign 0.00
R1942:Nsun7 UTSW 5 66284245 missense probably benign 0.00
R1981:Nsun7 UTSW 5 66261214 missense probably damaging 0.99
R2037:Nsun7 UTSW 5 66261086 missense probably benign 0.06
R2226:Nsun7 UTSW 5 66261219 nonsense probably null
R2996:Nsun7 UTSW 5 66295554 missense probably benign 0.01
R3882:Nsun7 UTSW 5 66278640 missense probably damaging 0.99
R4678:Nsun7 UTSW 5 66261064 missense probably benign 0.00
R4681:Nsun7 UTSW 5 66261199 missense probably benign 0.00
R4997:Nsun7 UTSW 5 66295839 missense probably benign 0.02
R6108:Nsun7 UTSW 5 66295799 missense probably damaging 0.99
R6465:Nsun7 UTSW 5 66295586 missense probably benign 0.35
R6500:Nsun7 UTSW 5 66295484 missense probably benign 0.11
R6746:Nsun7 UTSW 5 66283737 critical splice donor site probably null
R6925:Nsun7 UTSW 5 66277072 missense probably damaging 1.00
R7032:Nsun7 UTSW 5 66264035 missense probably benign 0.02
R7084:Nsun7 UTSW 5 66295421 missense probably damaging 1.00
R7098:Nsun7 UTSW 5 66260983 missense probably damaging 0.98
R7216:Nsun7 UTSW 5 66278657 missense probably damaging 1.00
R7276:Nsun7 UTSW 5 66277141 missense probably benign 0.03
R7803:Nsun7 UTSW 5 66276541 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACATGCTGCATCCAGAATTC -3'
(R):5'- GTCCCTTATCCAATGAATACAAGC -3'

Sequencing Primer
(F):5'- GCTGCATCCAGAATTCAGATTTTC -3'
(R):5'- TTATCCAATGAATACAAGCAGTCC -3'
Posted On2014-09-18