Incidental Mutation 'R2098:Supt6'
ID230383
Institutional Source Beutler Lab
Gene Symbol Supt6
Ensembl Gene ENSMUSG00000002052
Gene Namesuppressor of Ty 6
SynonymsSPT6, Supt6h, 5131400N11Rik
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2098 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78206746-78245987 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 78213261 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121]
Predicted Effect probably null
Transcript: ENSMUST00000002121
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108314
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during pre-implantation development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Supt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Supt6 APN 11 78231181 missense possibly damaging 0.94
IGL01457:Supt6 APN 11 78221143 missense probably damaging 1.00
IGL01608:Supt6 APN 11 78225483 missense probably damaging 1.00
IGL01739:Supt6 APN 11 78222187 missense probably damaging 1.00
IGL01765:Supt6 APN 11 78222159 missense probably benign 0.09
IGL01894:Supt6 APN 11 78222838 missense probably benign 0.00
IGL01952:Supt6 APN 11 78225760 missense probably benign 0.01
IGL02067:Supt6 APN 11 78231157 missense probably benign 0.01
IGL02244:Supt6 APN 11 78232797 missense possibly damaging 0.92
IGL02267:Supt6 APN 11 78226204 missense possibly damaging 0.72
IGL02379:Supt6 APN 11 78225369 missense possibly damaging 0.75
IGL02541:Supt6 APN 11 78226918 missense probably damaging 0.99
IGL02635:Supt6 APN 11 78212739 missense probably damaging 1.00
IGL03347:Supt6 APN 11 78232185 missense possibly damaging 0.71
IGL02980:Supt6 UTSW 11 78225722 missense probably damaging 1.00
IGL02991:Supt6 UTSW 11 78225353 missense probably damaging 1.00
R0145:Supt6 UTSW 11 78208236 missense probably benign 0.22
R0371:Supt6 UTSW 11 78223157 missense probably benign 0.00
R0452:Supt6 UTSW 11 78227003 missense probably damaging 1.00
R0464:Supt6 UTSW 11 78216338 missense probably benign 0.33
R0616:Supt6 UTSW 11 78209495 missense probably damaging 1.00
R0653:Supt6 UTSW 11 78226015 missense probably benign 0.01
R0788:Supt6 UTSW 11 78207772 unclassified probably benign
R1103:Supt6 UTSW 11 78225473 missense possibly damaging 0.59
R1282:Supt6 UTSW 11 78228768 missense possibly damaging 0.83
R1460:Supt6 UTSW 11 78222198 missense possibly damaging 0.93
R1508:Supt6 UTSW 11 78216203 critical splice donor site probably null
R1850:Supt6 UTSW 11 78219877 splice site probably benign
R1854:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R1855:Supt6 UTSW 11 78232540 missense possibly damaging 0.51
R2054:Supt6 UTSW 11 78224361 splice site probably benign
R2146:Supt6 UTSW 11 78230932 missense probably damaging 1.00
R2167:Supt6 UTSW 11 78208167 missense possibly damaging 0.94
R4621:Supt6 UTSW 11 78212746 missense possibly damaging 0.65
R4734:Supt6 UTSW 11 78224683 missense probably benign 0.01
R4825:Supt6 UTSW 11 78208134 missense possibly damaging 0.84
R5575:Supt6 UTSW 11 78228961 missense probably damaging 1.00
R5789:Supt6 UTSW 11 78233586 missense unknown
R5889:Supt6 UTSW 11 78212748 missense probably damaging 0.98
R6296:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6297:Supt6 UTSW 11 78226059 missense possibly damaging 0.48
R6394:Supt6 UTSW 11 78231065 missense probably damaging 1.00
R6702:Supt6 UTSW 11 78231800 missense possibly damaging 0.93
R6737:Supt6 UTSW 11 78231818 missense probably damaging 0.99
R6751:Supt6 UTSW 11 78208949 missense probably benign 0.09
R6853:Supt6 UTSW 11 78232830 missense possibly damaging 0.85
R7213:Supt6 UTSW 11 78232150 missense probably damaging 1.00
R7259:Supt6 UTSW 11 78207616 missense probably damaging 0.99
R7609:Supt6 UTSW 11 78226951 missense probably benign 0.01
R7776:Supt6 UTSW 11 78209529 missense probably damaging 0.99
X0067:Supt6 UTSW 11 78232675 missense probably benign
Z1176:Supt6 UTSW 11 78211836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATACCAATGAGGCGTTAGC -3'
(R):5'- TTCACTGCCGGATCATGAAG -3'

Sequencing Primer
(F):5'- GCGTTAGCCTCAGTTCTTATGCTG -3'
(R):5'- GATCGATATTGAAAAGTTCAGTGCAG -3'
Posted On2014-09-18