Incidental Mutation 'R2098:Cyth1'
ID230386
Institutional Source Beutler Lab
Gene Symbol Cyth1
Ensembl Gene ENSMUSG00000017132
Gene Namecytohesin 1
SynonymsCTH-1, Pscd1, CLM1
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2098 (G1)
Quality Score174
Status Not validated
Chromosome11
Chromosomal Location118132019-118248592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118193653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 25 (I25F)
Ref Sequence ENSEMBL: ENSMUSP00000114792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]
Predicted Effect probably damaging
Transcript: ENSMUST00000017276
AA Change: I23F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132
AA Change: I23F

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 378 4.8e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100181
AA Change: I37F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132
AA Change: I37F

DomainStartEndE-ValueType
Sec7 73 258 1.38e-108 SMART
PH 275 392 1.65e-23 SMART
low complexity region 402 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106302
AA Change: I25F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132
AA Change: I25F

DomainStartEndE-ValueType
Sec7 61 246 1.38e-108 SMART
PH 263 381 4.18e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106305
AA Change: I23F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132
AA Change: I23F

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 379 4.18e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141243
Predicted Effect probably damaging
Transcript: ENSMUST00000151165
AA Change: I25F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132
AA Change: I25F

DomainStartEndE-ValueType
SCOP:d1pbv__ 55 99 4e-15 SMART
PDB:1BC9|A 60 99 9e-21 PDB
Blast:Sec7 61 99 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc22a30 G A 19: 8,400,811 S167L probably damaging Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Cyth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Cyth1 APN 11 118193613 critical splice donor site probably null
IGL02047:Cyth1 APN 11 118169132 missense probably damaging 1.00
IGL02658:Cyth1 APN 11 118182246 missense probably damaging 0.99
IGL02826:Cyth1 APN 11 118185481 missense possibly damaging 0.89
Mucilage UTSW 11 118170860 missense probably damaging 1.00
Stuck UTSW 11 118185759 critical splice donor site probably null
tarred UTSW 11 118183923 nonsense probably null
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0470:Cyth1 UTSW 11 118132248 unclassified probably benign
R1387:Cyth1 UTSW 11 118182346 unclassified probably benign
R1599:Cyth1 UTSW 11 118177221 missense probably damaging 0.99
R2156:Cyth1 UTSW 11 118182808 missense probably damaging 1.00
R3546:Cyth1 UTSW 11 118192436 missense probably damaging 0.96
R4300:Cyth1 UTSW 11 118183894 missense probably damaging 0.98
R4589:Cyth1 UTSW 11 118184985 missense possibly damaging 0.70
R4799:Cyth1 UTSW 11 118183942 missense probably damaging 1.00
R5165:Cyth1 UTSW 11 118169082 missense possibly damaging 0.82
R5524:Cyth1 UTSW 11 118182767 missense probably benign 0.27
R5834:Cyth1 UTSW 11 118192463 critical splice acceptor site probably null
R5933:Cyth1 UTSW 11 118185759 critical splice donor site probably null
R5960:Cyth1 UTSW 11 118132367 unclassified probably benign
R6609:Cyth1 UTSW 11 118170860 missense probably damaging 1.00
R7014:Cyth1 UTSW 11 118212651 missense probably benign
R7108:Cyth1 UTSW 11 118182913 missense probably damaging 0.99
R7237:Cyth1 UTSW 11 118185495 missense probably damaging 1.00
R7401:Cyth1 UTSW 11 118182251 missense possibly damaging 0.94
R7424:Cyth1 UTSW 11 118184009 splice site probably null
R7523:Cyth1 UTSW 11 118183923 nonsense probably null
R7574:Cyth1 UTSW 11 118182863 missense probably damaging 1.00
R7647:Cyth1 UTSW 11 118177288 missense probably benign 0.00
R7731:Cyth1 UTSW 11 118169053 missense possibly damaging 0.55
R7848:Cyth1 UTSW 11 118183923 nonsense probably null
R7849:Cyth1 UTSW 11 118183923 nonsense probably null
X0063:Cyth1 UTSW 11 118132329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGATAAACGGCAGTAGGG -3'
(R):5'- TTCATAACCCTGCCCGAGTG -3'

Sequencing Primer
(F):5'- GAGCCTCTACTTTCTGGGAAAC -3'
(R):5'- TGGTTCCCAGCAGGCCATC -3'
Posted On2014-09-18