Incidental Mutation 'R2098:Slc22a30'
ID 230401
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Name solute carrier family 22, member 30
Synonyms
MMRRC Submission 040102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R2098 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 8335371-8405111 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8400811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 167 (S167L)
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]
AlphaFold Q96LX3
Predicted Effect probably damaging
Transcript: ENSMUST00000064507
AA Change: S167L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: S167L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096269
AA Change: S167L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: S167L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120540
AA Change: S167L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: S167L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 435 1.3e-20 PFAM
Pfam:MFS_1 127 435 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,036,579 E1316G probably damaging Het
Arhgap32 C A 9: 32,259,911 T1329K probably damaging Het
Arhgef10l G C 4: 140,579,432 L104V probably damaging Het
Bend3 T C 10: 43,510,504 S298P probably damaging Het
Cacna1b C T 2: 24,650,546 V1385M probably damaging Het
Camk2d G A 3: 126,780,442 G166D probably damaging Het
Cd84 G A 1: 171,885,581 C291Y probably benign Het
Cdhr2 A G 13: 54,715,644 I113V probably benign Het
Cfap206 G A 4: 34,719,053 Q318* probably null Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Cyth1 T A 11: 118,193,653 I25F probably damaging Het
D3Ertd254e T A 3: 36,166,140 S771T probably benign Het
Dock2 A T 11: 34,266,279 N1208K probably benign Het
Dock2 A G 11: 34,719,005 S203P probably damaging Het
Ehbp1l1 G T 19: 5,708,658 T1652K possibly damaging Het
Eps8l2 G A 7: 141,355,792 probably null Het
Gm10250 A G 15: 5,120,814 probably benign Het
Gm9772 T C 17: 22,006,637 H94R probably benign Het
Hspg2 G A 4: 137,520,109 G1184D probably damaging Het
Igfn1 T A 1: 135,978,305 D255V probably damaging Het
Marf1 T C 16: 14,114,200 H1651R probably benign Het
Mllt10 T C 2: 18,162,653 V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 S76L probably benign Het
Mrps2 C A 2: 28,468,315 T39K probably benign Het
Myo6 T C 9: 80,281,526 Y715H probably damaging Het
Nsun7 A G 5: 66,283,712 E392G probably damaging Het
Obscn C T 11: 59,069,991 E3374K probably damaging Het
Oit1 T C 14: 8,361,479 I47V probably benign Het
Olfr1136 A T 2: 87,693,729 M51K probably benign Het
Olfr1206 A T 2: 88,864,871 I89F probably benign Het
Olfr434 G A 6: 43,217,503 V197I probably benign Het
Olfr684 A G 7: 105,157,271 V137A probably benign Het
Pkd2 C T 5: 104,478,902 P317S probably damaging Het
Prl5a1 T C 13: 28,145,505 S56P probably damaging Het
Psmd1 A G 1: 86,082,101 probably null Het
Ptchd3 T C 11: 121,842,479 C732R probably damaging Het
Rad51c A T 11: 87,402,763 V71E probably benign Het
Scn11a A T 9: 119,792,494 I619K possibly damaging Het
Sgpp1 T G 12: 75,716,510 D299A probably damaging Het
Slc16a4 C A 3: 107,300,847 Y224* probably null Het
Slc6a5 T C 7: 49,945,567 I559T probably damaging Het
Spire1 A G 18: 67,503,466 F364L probably damaging Het
Srek1 G A 13: 103,744,855 T421I unknown Het
St8sia4 T C 1: 95,653,528 H163R probably damaging Het
Supt6 A G 11: 78,213,261 probably null Het
Tas2r103 T C 6: 133,036,597 T169A probably benign Het
Thrap3 A G 4: 126,180,030 S308P probably damaging Het
V1rd19 C T 7: 24,003,735 L209F probably damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8370197 missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8336849 missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5193:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5255:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5481:Slc22a30 UTSW 19 8336837 missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8335771 missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6327:Slc22a30 UTSW 19 8335722 utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8336717 splice site probably null
R7375:Slc22a30 UTSW 19 8404691 missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8335708 missense unknown
R7755:Slc22a30 UTSW 19 8336769 missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8404540 nonsense probably null
R8248:Slc22a30 UTSW 19 8370199 missense probably benign 0.12
R8677:Slc22a30 UTSW 19 8386671 missense probably benign 0.21
R8854:Slc22a30 UTSW 19 8386390 critical splice donor site probably null
R8900:Slc22a30 UTSW 19 8337976 missense probably damaging 1.00
R9185:Slc22a30 UTSW 19 8344553 missense probably benign 0.03
R9296:Slc22a30 UTSW 19 8386755 missense probably benign 0.06
R9463:Slc22a30 UTSW 19 8400895 missense probably damaging 1.00
R9773:Slc22a30 UTSW 19 8344390 missense probably benign 0.01
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCTTGTTGACCTGACTCTTG -3'
(R):5'- CTGCAGAGAGTTAAATGGAGTTTC -3'

Sequencing Primer
(F):5'- TGACCTGACTCTTGAATATCTATCTG -3'
(R):5'- ATAATATTAGGGGTTATGGTGAAGGC -3'
Posted On 2014-09-18