Incidental Mutation 'R2098:Slc22a30'
ID 230401
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Name solute carrier family 22, member 30
Synonyms C730048C13Rik
MMRRC Submission 040102-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R2098 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 8312735-8382475 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8378175 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 167 (S167L)
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]
AlphaFold Q96LX3
Predicted Effect probably damaging
Transcript: ENSMUST00000064507
AA Change: S167L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: S167L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096269
AA Change: S167L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: S167L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120540
AA Change: S167L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: S167L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 435 1.3e-20 PFAM
Pfam:MFS_1 127 435 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 109,927,405 (GRCm39) E1316G probably damaging Het
Arhgap32 C A 9: 32,171,207 (GRCm39) T1329K probably damaging Het
Arhgef10l G C 4: 140,306,743 (GRCm39) L104V probably damaging Het
Bend3 T C 10: 43,386,500 (GRCm39) S298P probably damaging Het
Cacna1b C T 2: 24,540,558 (GRCm39) V1385M probably damaging Het
Camk2d G A 3: 126,574,091 (GRCm39) G166D probably damaging Het
Cd84 G A 1: 171,713,148 (GRCm39) C291Y probably benign Het
Cdhr2 A G 13: 54,863,457 (GRCm39) I113V probably benign Het
Cfap206 G A 4: 34,719,053 (GRCm39) Q318* probably null Het
Chd9 C T 8: 91,760,615 (GRCm39) P2120L probably benign Het
Cyth1 T A 11: 118,084,479 (GRCm39) I25F probably damaging Het
Dock2 A T 11: 34,216,279 (GRCm39) N1208K probably benign Het
Dock2 A G 11: 34,609,832 (GRCm39) S203P probably damaging Het
Ehbp1l1 G T 19: 5,758,686 (GRCm39) T1652K possibly damaging Het
Eps8l2 G A 7: 140,935,705 (GRCm39) probably null Het
Fam3d T C 14: 8,361,479 (GRCm38) I47V probably benign Het
Gm10250 A G 15: 5,150,296 (GRCm39) probably benign Het
Gm9772 T C 17: 22,225,618 (GRCm39) H94R probably benign Het
Hspg2 G A 4: 137,247,420 (GRCm39) G1184D probably damaging Het
Igfn1 T A 1: 135,906,043 (GRCm39) D255V probably damaging Het
Marf1 T C 16: 13,932,064 (GRCm39) H1651R probably benign Het
Mllt10 T C 2: 18,167,464 (GRCm39) V385A possibly damaging Het
Mmp1b G A 9: 7,386,984 (GRCm39) S76L probably benign Het
Mrps2 C A 2: 28,358,327 (GRCm39) T39K probably benign Het
Myo6 T C 9: 80,188,808 (GRCm39) Y715H probably damaging Het
Nsun7 A G 5: 66,441,055 (GRCm39) E392G probably damaging Het
Obscn C T 11: 58,960,817 (GRCm39) E3374K probably damaging Het
Or2a20 G A 6: 43,194,437 (GRCm39) V197I probably benign Het
Or4c11 A T 2: 88,695,215 (GRCm39) I89F probably benign Het
Or56a4 A G 7: 104,806,478 (GRCm39) V137A probably benign Het
Or5w13 A T 2: 87,524,073 (GRCm39) M51K probably benign Het
Pkd2 C T 5: 104,626,768 (GRCm39) P317S probably damaging Het
Prl5a1 T C 13: 28,329,488 (GRCm39) S56P probably damaging Het
Psmd1 A G 1: 86,009,823 (GRCm39) probably null Het
Ptchd3 T C 11: 121,733,305 (GRCm39) C732R probably damaging Het
Rad51c A T 11: 87,293,589 (GRCm39) V71E probably benign Het
Scn11a A T 9: 119,621,560 (GRCm39) I619K possibly damaging Het
Sgpp1 T G 12: 75,763,284 (GRCm39) D299A probably damaging Het
Slc16a4 C A 3: 107,208,163 (GRCm39) Y224* probably null Het
Slc6a5 T C 7: 49,595,315 (GRCm39) I559T probably damaging Het
Spire1 A G 18: 67,636,536 (GRCm39) F364L probably damaging Het
Srek1 G A 13: 103,881,363 (GRCm39) T421I unknown Het
St8sia4 T C 1: 95,581,253 (GRCm39) H163R probably damaging Het
Supt6 A G 11: 78,104,087 (GRCm39) probably null Het
Tas2r103 T C 6: 133,013,560 (GRCm39) T169A probably benign Het
Thrap3 A G 4: 126,073,823 (GRCm39) S308P probably damaging Het
V1rd19 C T 7: 23,703,160 (GRCm39) L209F probably damaging Het
Zfp267 T A 3: 36,220,289 (GRCm39) S771T probably benign Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8,313,152 (GRCm39) missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8,364,021 (GRCm39) missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8,378,259 (GRCm39) missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8,347,449 (GRCm39) missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8,315,322 (GRCm39) missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8,347,561 (GRCm39) missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8,322,721 (GRCm39) missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8,313,165 (GRCm39) nonsense probably null
R1781:Slc22a30 UTSW 19 8,313,136 (GRCm39) missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8,314,213 (GRCm39) missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8,381,909 (GRCm39) missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8,321,768 (GRCm39) missense probably benign
R5108:Slc22a30 UTSW 19 8,363,790 (GRCm39) missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5192:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5193:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5195:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5253:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5254:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5255:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5256:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5377:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5378:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5400:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5401:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5481:Slc22a30 UTSW 19 8,314,201 (GRCm39) missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8,381,980 (GRCm39) missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8,313,135 (GRCm39) missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5704:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5706:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5767:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5770:Slc22a30 UTSW 19 8,363,891 (GRCm39) missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5793:Slc22a30 UTSW 19 8,314,183 (GRCm39) missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8,381,945 (GRCm39) missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8,315,232 (GRCm39) splice site probably null
R6105:Slc22a30 UTSW 19 8,315,232 (GRCm39) splice site probably null
R6327:Slc22a30 UTSW 19 8,313,086 (GRCm39) utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8,364,065 (GRCm39) missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8,314,081 (GRCm39) splice site probably null
R7375:Slc22a30 UTSW 19 8,382,055 (GRCm39) missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8,313,072 (GRCm39) missense unknown
R7755:Slc22a30 UTSW 19 8,314,133 (GRCm39) missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8,381,904 (GRCm39) nonsense probably null
R8248:Slc22a30 UTSW 19 8,347,563 (GRCm39) missense probably benign 0.12
R8677:Slc22a30 UTSW 19 8,364,035 (GRCm39) missense probably benign 0.21
R8854:Slc22a30 UTSW 19 8,363,754 (GRCm39) critical splice donor site probably null
R8900:Slc22a30 UTSW 19 8,315,340 (GRCm39) missense probably damaging 1.00
R9185:Slc22a30 UTSW 19 8,321,917 (GRCm39) missense probably benign 0.03
R9296:Slc22a30 UTSW 19 8,364,119 (GRCm39) missense probably benign 0.06
R9463:Slc22a30 UTSW 19 8,378,259 (GRCm39) missense probably damaging 1.00
R9773:Slc22a30 UTSW 19 8,321,754 (GRCm39) missense probably benign 0.01
Z1088:Slc22a30 UTSW 19 8,313,139 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCTTGTTGACCTGACTCTTG -3'
(R):5'- CTGCAGAGAGTTAAATGGAGTTTC -3'

Sequencing Primer
(F):5'- TGACCTGACTCTTGAATATCTATCTG -3'
(R):5'- ATAATATTAGGGGTTATGGTGAAGGC -3'
Posted On 2014-09-18