Incidental Mutation 'R2100:Stx12'
ID230419
Institutional Source Beutler Lab
Gene Symbol Stx12
Ensembl Gene ENSMUSG00000028879
Gene Namesyntaxin 12
SynonymsStx13, syntaxin 13
MMRRC Submission 040104-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R2100 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location132853501-132884509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132860602 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 173 (I173N)
Ref Sequence ENSEMBL: ENSMUSP00000030698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030698]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030698
AA Change: I173N

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030698
Gene: ENSMUSG00000028879
AA Change: I173N

DomainStartEndE-ValueType
SynN 14 129 2.7e-32 SMART
t_SNARE 173 240 4.07e-20 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137109
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,500,249 N238S probably damaging Het
Abca3 C T 17: 24,408,209 R1295W probably damaging Het
Abca8b A T 11: 109,937,782 I1430N probably damaging Het
Abcb1a A G 5: 8,713,202 T577A probably damaging Het
Arl5b G A 2: 15,073,195 M101I probably benign Het
C1qbp T A 11: 70,978,102 N278I probably benign Het
Cdh1 A T 8: 106,659,668 T408S possibly damaging Het
Cfap54 T A 10: 93,001,937 I1034F possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Chil4 T C 3: 106,214,347 K62R probably benign Het
Crebl2 A G 6: 134,851,203 T113A probably benign Het
Cyp2c69 C A 19: 39,886,686 V8L probably benign Het
Dpp6 A G 5: 27,664,744 R447G probably damaging Het
Efcab6 A T 15: 83,892,967 probably null Het
Emilin1 T G 5: 30,917,897 V494G probably benign Het
Enoph1 A G 5: 100,063,786 I181V probably null Het
F3 T C 3: 121,732,433 V215A possibly damaging Het
Fat3 G T 9: 16,377,430 H266N possibly damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Garnl3 T C 2: 33,046,645 T171A probably benign Het
Hspa4l T C 3: 40,772,658 V476A possibly damaging Het
Impg2 A G 16: 56,231,385 probably null Het
Kctd6 T C 14: 8,222,239 L27P possibly damaging Het
Kmt2d G T 15: 98,846,480 probably benign Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,201,788 probably benign Het
Lrig2 A G 3: 104,511,630 L21P possibly damaging Het
Macf1 G A 4: 123,397,906 Q3284* probably null Het
Mnt A G 11: 74,831,351 E8G probably damaging Het
Nbeal1 A G 1: 60,305,271 probably null Het
Nid2 C T 14: 19,778,878 Q331* probably null Het
Nlrx1 A G 9: 44,262,608 L432P probably damaging Het
Nop2 T A 6: 125,140,822 D445E probably damaging Het
Nup62 T C 7: 44,829,497 probably benign Het
Oas2 A G 5: 120,745,675 probably null Het
Olfr1090 A T 2: 86,754,561 M59K possibly damaging Het
Olfr1128 T A 2: 87,544,825 T240S probably damaging Het
Olfr1480 A G 19: 13,530,434 I298V probably benign Het
Olfr1499 A G 19: 13,815,236 M118T possibly damaging Het
Olfr491 A T 7: 108,317,554 Y220F probably benign Het
P3h3 T A 6: 124,845,042 T623S probably damaging Het
Pkp3 T C 7: 141,083,292 V350A probably damaging Het
Plekha3 T A 2: 76,692,663 I225N probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf213 A T 11: 119,467,302 K4292* probably null Het
Rtkn T C 6: 83,149,560 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Snx10 T C 6: 51,588,415 Y171H probably damaging Het
Thrb T A 14: 18,030,393 M379K possibly damaging Het
Tmem132e T A 11: 82,444,531 V813E probably damaging Het
Tnfsf12 T C 11: 69,687,349 E134G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpbgl T A 7: 99,626,444 I69F possibly damaging Het
Ythdc1 T A 5: 86,816,685 S130T possibly damaging Het
Zbp1 A G 2: 173,209,244 S278P probably damaging Het
Zfp30 A G 7: 29,793,526 T483A probably benign Het
Zfp322a G A 13: 23,357,290 S94L possibly damaging Het
Zfp646 T G 7: 127,882,187 Y1179D probably damaging Het
Other mutations in Stx12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Stx12 APN 4 132863265 missense probably benign 0.06
IGL01484:Stx12 APN 4 132884362 missense probably damaging 0.99
IGL03073:Stx12 APN 4 132858449 missense probably benign 0.00
IGL03090:Stx12 APN 4 132863229 missense probably benign
R0433:Stx12 UTSW 4 132858430 missense probably damaging 1.00
R0725:Stx12 UTSW 4 132857390 splice site probably benign
R1404:Stx12 UTSW 4 132871649 missense probably benign
R1404:Stx12 UTSW 4 132871649 missense probably benign
R1417:Stx12 UTSW 4 132860542 critical splice donor site probably null
R1711:Stx12 UTSW 4 132858477 missense probably damaging 1.00
R3085:Stx12 UTSW 4 132857361 missense probably damaging 1.00
R7272:Stx12 UTSW 4 132857376 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGCAGAAGTTCAATTTTGCCAC -3'
(R):5'- TGGATGAGAATACGGCCCAC -3'

Sequencing Primer
(F):5'- GAGGTCCTGAGTTCAAATTCCAGC -3'
(R):5'- CCACGGGGATTTTGTACTGATAGC -3'
Posted On2014-09-18