Incidental Mutation 'R0179:Muc2'
ID 23043
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 038447-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R0179 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141302708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 17 (Y17C)
Ref Sequence ENSEMBL: ENSMUSP00000026590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026590
AA Change: Y17C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: Y17C

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187945
AA Change: Y456C
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 C T 16: 85,592,353 (GRCm39) S948N probably benign Het
Adck1 A T 12: 88,425,942 (GRCm39) M457L possibly damaging Het
Adprm A T 11: 66,929,051 (GRCm39) H313Q possibly damaging Het
Adss1 T C 12: 112,598,703 (GRCm39) I104T probably benign Het
Agxt2 A C 15: 10,399,134 (GRCm39) Q435P possibly damaging Het
Amotl1 G A 9: 14,460,069 (GRCm39) A890V probably benign Het
Ankrd50 A G 3: 38,509,463 (GRCm39) V968A possibly damaging Het
Brf2 T C 8: 27,615,896 (GRCm39) D163G possibly damaging Het
Cd226 C A 18: 89,225,263 (GRCm39) N53K probably benign Het
Cdc42ep2 T C 19: 5,968,636 (GRCm39) D23G probably benign Het
Cdc7 T C 5: 107,112,905 (GRCm39) S8P probably benign Het
Cdh8 C T 8: 99,838,344 (GRCm39) E499K possibly damaging Het
Chd7 T A 4: 8,862,516 (GRCm39) F2534L probably benign Het
Ckb T C 12: 111,636,610 (GRCm39) T255A probably benign Het
Cntnap5c G T 17: 58,076,620 (GRCm39) W19L probably benign Het
Cntrl A G 2: 35,057,871 (GRCm39) E1854G probably benign Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cop1 A G 1: 159,077,636 (GRCm39) D157G probably benign Het
Csf2rb A C 15: 78,220,572 (GRCm39) Q38P possibly damaging Het
Ctla2b T C 13: 61,044,107 (GRCm39) D52G possibly damaging Het
Dcaf7 A T 11: 105,942,623 (GRCm39) D190V probably damaging Het
Depdc5 T A 5: 33,058,918 (GRCm39) probably benign Het
Dgkq A G 5: 108,806,066 (GRCm39) probably benign Het
Dhrs2 A G 14: 55,477,933 (GRCm39) T222A probably damaging Het
Dock1 G A 7: 134,700,566 (GRCm39) D1109N probably damaging Het
E4f1 G C 17: 24,670,411 (GRCm39) T92S possibly damaging Het
Ep400 A T 5: 110,816,515 (GRCm39) S2669T probably damaging Het
Eprs1 T G 1: 185,145,744 (GRCm39) D1184E probably benign Het
Fpr-rs4 A T 17: 18,242,289 (GRCm39) K99* probably null Het
Fzr1 A T 10: 81,204,904 (GRCm39) probably benign Het
Gcc2 C T 10: 58,112,472 (GRCm39) R1001C probably benign Het
Gm4884 A G 7: 40,693,252 (GRCm39) D407G probably benign Het
Golga4 A T 9: 118,389,808 (GRCm39) probably null Het
Gp2 T G 7: 119,051,540 (GRCm39) D225A possibly damaging Het
Gramd1a T A 7: 30,841,843 (GRCm39) T120S probably damaging Het
Hbb-bh2 T A 7: 103,488,434 (GRCm39) N121I probably benign Het
Htr6 A T 4: 138,789,437 (GRCm39) L276Q probably damaging Het
Itga9 A T 9: 118,490,454 (GRCm39) I262F probably benign Het
Lamc3 A G 2: 31,805,096 (GRCm39) probably benign Het
Large1 T C 8: 73,825,474 (GRCm39) N200S probably benign Het
Lct C T 1: 128,255,422 (GRCm39) V207I probably benign Het
Marf1 C A 16: 13,969,040 (GRCm39) L144F probably damaging Het
Morc2b A T 17: 33,355,956 (GRCm39) Y605* probably null Het
Mtus1 G T 8: 41,455,398 (GRCm39) L87I possibly damaging Het
Myf5 T C 10: 107,321,779 (GRCm39) D5G possibly damaging Het
Nasp C T 4: 116,459,354 (GRCm39) V375M probably damaging Het
Nr1h2 A T 7: 44,201,689 (GRCm39) probably null Het
Nrg2 T C 18: 36,155,468 (GRCm39) Q447R probably benign Het
Ntn5 G A 7: 45,335,737 (GRCm39) G56D probably damaging Het
Oasl2 A G 5: 115,048,973 (GRCm39) R138G probably benign Het
Or4c29 A T 2: 88,740,237 (GRCm39) C167S possibly damaging Het
Or5b124 T A 19: 13,610,504 (GRCm39) F10I probably damaging Het
Or9k7 T C 10: 130,046,207 (GRCm39) Y264C probably damaging Het
Pcdhb5 G A 18: 37,455,612 (GRCm39) G664D probably damaging Het
Ppp1r15a T C 7: 45,174,424 (GRCm39) E128G probably damaging Het
Prpf19 T C 19: 10,875,172 (GRCm39) probably benign Het
Ptpn3 T A 4: 57,270,118 (GRCm39) T15S probably benign Het
R3hdm2 G A 10: 127,330,975 (GRCm39) C818Y probably damaging Het
Rad51d A G 11: 82,780,824 (GRCm39) V39A possibly damaging Het
Rptor A T 11: 119,763,193 (GRCm39) T926S probably benign Het
Rwdd4a G A 8: 47,995,742 (GRCm39) D41N probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Spata31g1 T C 4: 42,972,214 (GRCm39) S516P probably benign Het
Ssbp3 T C 4: 106,903,585 (GRCm39) S334P probably damaging Het
Suco A G 1: 161,703,874 (GRCm39) probably benign Het
Synj1 T C 16: 90,761,519 (GRCm39) K649R possibly damaging Het
Tdp2 C T 13: 25,024,431 (GRCm39) H243Y possibly damaging Het
Tinag A G 9: 76,904,164 (GRCm39) probably benign Het
Trerf1 T C 17: 47,627,588 (GRCm39) noncoding transcript Het
Trip10 T C 17: 57,569,349 (GRCm39) probably benign Het
Tsen54 A T 11: 115,712,856 (GRCm39) S131C probably damaging Het
Unc5c A T 3: 141,523,828 (GRCm39) R794* probably null Het
Vmn2r59 A T 7: 41,696,432 (GRCm39) Y103* probably null Het
Washc5 A G 15: 59,224,379 (GRCm39) V460A probably benign Het
Wdr87-ps A G 7: 29,235,365 (GRCm39) noncoding transcript Het
Whamm A G 7: 81,243,763 (GRCm39) T358A probably benign Het
Xlr4b C T X: 72,262,277 (GRCm39) probably benign Het
Zbbx C T 3: 74,992,869 (GRCm39) probably benign Het
Zdhhc23 G A 16: 43,794,066 (GRCm39) P203S probably benign Het
Zfp27 T A 7: 29,595,850 (GRCm39) E38D possibly damaging Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTGGAAGGGAACATCCTGGCAAC -3'
(R):5'- TGAGAGGCACTTACAGCAGACTCC -3'

Sequencing Primer
(F):5'- CCTGGCAACTAGTGACTATTGAG -3'
(R):5'- TACAGCAGACTCCCTGGGTG -3'
Posted On 2013-04-16