Incidental Mutation 'R2100:Nop2'
ID230433
Institutional Source Beutler Lab
Gene Symbol Nop2
Ensembl Gene ENSMUSG00000038279
Gene NameNOP2 nucleolar protein
Synonyms120kDa, Nol1
MMRRC Submission 040104-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2100 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125131909-125144753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125140822 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 445 (D445E)
Ref Sequence ENSEMBL: ENSMUSP00000047123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000117675] [ENSMUST00000119527] [ENSMUST00000144364]
Predicted Effect probably damaging
Transcript: ENSMUST00000044200
AA Change: D445E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279
AA Change: D445E

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141230
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148835
SMART Domains Protein: ENSMUSP00000115080
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
Filament 34 348 4.99e-2 SMART
low complexity region 356 379 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,500,249 N238S probably damaging Het
Abca3 C T 17: 24,408,209 R1295W probably damaging Het
Abca8b A T 11: 109,937,782 I1430N probably damaging Het
Abcb1a A G 5: 8,713,202 T577A probably damaging Het
Arl5b G A 2: 15,073,195 M101I probably benign Het
C1qbp T A 11: 70,978,102 N278I probably benign Het
Cdh1 A T 8: 106,659,668 T408S possibly damaging Het
Cfap54 T A 10: 93,001,937 I1034F possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Chil4 T C 3: 106,214,347 K62R probably benign Het
Crebl2 A G 6: 134,851,203 T113A probably benign Het
Cyp2c69 C A 19: 39,886,686 V8L probably benign Het
Dpp6 A G 5: 27,664,744 R447G probably damaging Het
Efcab6 A T 15: 83,892,967 probably null Het
Emilin1 T G 5: 30,917,897 V494G probably benign Het
Enoph1 A G 5: 100,063,786 I181V probably null Het
F3 T C 3: 121,732,433 V215A possibly damaging Het
Fat3 G T 9: 16,377,430 H266N possibly damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Garnl3 T C 2: 33,046,645 T171A probably benign Het
Hspa4l T C 3: 40,772,658 V476A possibly damaging Het
Impg2 A G 16: 56,231,385 probably null Het
Kctd6 T C 14: 8,222,239 L27P possibly damaging Het
Kmt2d G T 15: 98,846,480 probably benign Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,201,788 probably benign Het
Lrig2 A G 3: 104,511,630 L21P possibly damaging Het
Macf1 G A 4: 123,397,906 Q3284* probably null Het
Mnt A G 11: 74,831,351 E8G probably damaging Het
Nbeal1 A G 1: 60,305,271 probably null Het
Nid2 C T 14: 19,778,878 Q331* probably null Het
Nlrx1 A G 9: 44,262,608 L432P probably damaging Het
Nup62 T C 7: 44,829,497 probably benign Het
Oas2 A G 5: 120,745,675 probably null Het
Olfr1090 A T 2: 86,754,561 M59K possibly damaging Het
Olfr1128 T A 2: 87,544,825 T240S probably damaging Het
Olfr1480 A G 19: 13,530,434 I298V probably benign Het
Olfr1499 A G 19: 13,815,236 M118T possibly damaging Het
Olfr491 A T 7: 108,317,554 Y220F probably benign Het
P3h3 T A 6: 124,845,042 T623S probably damaging Het
Pkp3 T C 7: 141,083,292 V350A probably damaging Het
Plekha3 T A 2: 76,692,663 I225N probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf213 A T 11: 119,467,302 K4292* probably null Het
Rtkn T C 6: 83,149,560 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Snx10 T C 6: 51,588,415 Y171H probably damaging Het
Stx12 A T 4: 132,860,602 I173N possibly damaging Het
Thrb T A 14: 18,030,393 M379K possibly damaging Het
Tmem132e T A 11: 82,444,531 V813E probably damaging Het
Tnfsf12 T C 11: 69,687,349 E134G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpbgl T A 7: 99,626,444 I69F possibly damaging Het
Ythdc1 T A 5: 86,816,685 S130T possibly damaging Het
Zbp1 A G 2: 173,209,244 S278P probably damaging Het
Zfp30 A G 7: 29,793,526 T483A probably benign Het
Zfp322a G A 13: 23,357,290 S94L possibly damaging Het
Zfp646 T G 7: 127,882,187 Y1179D probably damaging Het
Other mutations in Nop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Nop2 APN 6 125133546 missense probably damaging 1.00
IGL00913:Nop2 APN 6 125139821 missense probably damaging 1.00
IGL02568:Nop2 APN 6 125140850 missense probably damaging 1.00
IGL02850:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02850:Nop2 APN 6 125144070 missense probably benign 0.01
IGL02851:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02851:Nop2 APN 6 125144070 missense probably benign 0.01
IGL03144:Nop2 APN 6 125137512 critical splice donor site probably null
IGL03338:Nop2 APN 6 125139732 splice site probably null
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0486:Nop2 UTSW 6 125140673 missense probably null 0.14
R0627:Nop2 UTSW 6 125139704 missense possibly damaging 0.90
R1022:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1024:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1068:Nop2 UTSW 6 125132279 missense probably damaging 0.99
R1750:Nop2 UTSW 6 125137638 missense probably benign 0.00
R1847:Nop2 UTSW 6 125137079 unclassified probably benign
R1940:Nop2 UTSW 6 125134634 missense probably benign 0.43
R1972:Nop2 UTSW 6 125134639 missense probably benign 0.02
R2059:Nop2 UTSW 6 125139860 missense probably null 0.95
R3123:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3124:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3160:Nop2 UTSW 6 125134592 missense probably benign 0.00
R3162:Nop2 UTSW 6 125134592 missense probably benign 0.00
R4521:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4522:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4523:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4524:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4571:Nop2 UTSW 6 125140881 critical splice donor site probably null
R4695:Nop2 UTSW 6 125144556 missense probably benign 0.00
R4747:Nop2 UTSW 6 125137094 missense probably benign
R5010:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5385:Nop2 UTSW 6 125144361 missense probably benign
R5455:Nop2 UTSW 6 125140643 missense probably benign 0.19
R5567:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5914:Nop2 UTSW 6 125134728 missense probably benign 0.01
R5993:Nop2 UTSW 6 125144019 missense probably benign 0.00
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6065:Nop2 UTSW 6 125144565 missense probably benign
R6352:Nop2 UTSW 6 125137207 missense probably benign
R6436:Nop2 UTSW 6 125137311 missense probably benign 0.01
R7393:Nop2 UTSW 6 125133546 nonsense probably null
R7499:Nop2 UTSW 6 125144208 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CATCAGCCACTATGATGGGC -3'
(R):5'- TCTCATCCTGCCCAAGAGAC -3'

Sequencing Primer
(F):5'- ACTATGATGGGCGCCAGTTC -3'
(R):5'- GGACTTCATGAGACAGCCTG -3'
Posted On2014-09-18