Incidental Mutation 'R2100:Tmem132e'
ID230451
Institutional Source Beutler Lab
Gene Symbol Tmem132e
Ensembl Gene ENSMUSG00000020701
Gene Nametransmembrane protein 132E
SynonymsLOC270893
MMRRC Submission 040104-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R2100 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82388900-82446332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82444531 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 813 (V813E)
Ref Sequence ENSEMBL: ENSMUSP00000052484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054245] [ENSMUST00000092852]
Predicted Effect probably damaging
Transcript: ENSMUST00000054245
AA Change: V813E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052484
Gene: ENSMUSG00000020701
AA Change: V813E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:TMEM132D_N 45 176 1.1e-52 PFAM
low complexity region 202 216 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
Pfam:TMEM132 451 797 1.7e-136 PFAM
low complexity region 827 837 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
Pfam:TMEM132D_C 867 944 2e-34 PFAM
low complexity region 967 998 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1036 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092852
AA Change: V721E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090528
Gene: ENSMUSG00000020701
AA Change: V721E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 226 236 N/A INTRINSIC
low complexity region 471 489 N/A INTRINSIC
low complexity region 735 745 N/A INTRINSIC
low complexity region 749 762 N/A INTRINSIC
transmembrane domain 798 820 N/A INTRINSIC
low complexity region 875 906 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
low complexity region 944 951 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202598
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,500,249 N238S probably damaging Het
Abca3 C T 17: 24,408,209 R1295W probably damaging Het
Abca8b A T 11: 109,937,782 I1430N probably damaging Het
Abcb1a A G 5: 8,713,202 T577A probably damaging Het
Arl5b G A 2: 15,073,195 M101I probably benign Het
C1qbp T A 11: 70,978,102 N278I probably benign Het
Cdh1 A T 8: 106,659,668 T408S possibly damaging Het
Cfap54 T A 10: 93,001,937 I1034F possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Chil4 T C 3: 106,214,347 K62R probably benign Het
Crebl2 A G 6: 134,851,203 T113A probably benign Het
Cyp2c69 C A 19: 39,886,686 V8L probably benign Het
Dpp6 A G 5: 27,664,744 R447G probably damaging Het
Efcab6 A T 15: 83,892,967 probably null Het
Emilin1 T G 5: 30,917,897 V494G probably benign Het
Enoph1 A G 5: 100,063,786 I181V probably null Het
F3 T C 3: 121,732,433 V215A possibly damaging Het
Fat3 G T 9: 16,377,430 H266N possibly damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Garnl3 T C 2: 33,046,645 T171A probably benign Het
Hspa4l T C 3: 40,772,658 V476A possibly damaging Het
Impg2 A G 16: 56,231,385 probably null Het
Kctd6 T C 14: 8,222,239 L27P possibly damaging Het
Kmt2d G T 15: 98,846,480 probably benign Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,201,788 probably benign Het
Lrig2 A G 3: 104,511,630 L21P possibly damaging Het
Macf1 G A 4: 123,397,906 Q3284* probably null Het
Mnt A G 11: 74,831,351 E8G probably damaging Het
Nbeal1 A G 1: 60,305,271 probably null Het
Nid2 C T 14: 19,778,878 Q331* probably null Het
Nlrx1 A G 9: 44,262,608 L432P probably damaging Het
Nop2 T A 6: 125,140,822 D445E probably damaging Het
Nup62 T C 7: 44,829,497 probably benign Het
Oas2 A G 5: 120,745,675 probably null Het
Olfr1090 A T 2: 86,754,561 M59K possibly damaging Het
Olfr1128 T A 2: 87,544,825 T240S probably damaging Het
Olfr1480 A G 19: 13,530,434 I298V probably benign Het
Olfr1499 A G 19: 13,815,236 M118T possibly damaging Het
Olfr491 A T 7: 108,317,554 Y220F probably benign Het
P3h3 T A 6: 124,845,042 T623S probably damaging Het
Pkp3 T C 7: 141,083,292 V350A probably damaging Het
Plekha3 T A 2: 76,692,663 I225N probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf213 A T 11: 119,467,302 K4292* probably null Het
Rtkn T C 6: 83,149,560 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Snx10 T C 6: 51,588,415 Y171H probably damaging Het
Stx12 A T 4: 132,860,602 I173N possibly damaging Het
Thrb T A 14: 18,030,393 M379K possibly damaging Het
Tnfsf12 T C 11: 69,687,349 E134G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpbgl T A 7: 99,626,444 I69F possibly damaging Het
Ythdc1 T A 5: 86,816,685 S130T possibly damaging Het
Zbp1 A G 2: 173,209,244 S278P probably damaging Het
Zfp30 A G 7: 29,793,526 T483A probably benign Het
Zfp322a G A 13: 23,357,290 S94L possibly damaging Het
Zfp646 T G 7: 127,882,187 Y1179D probably damaging Het
Other mutations in Tmem132e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Tmem132e APN 11 82438374 missense probably damaging 1.00
IGL01586:Tmem132e APN 11 82434669 missense probably damaging 1.00
IGL01729:Tmem132e APN 11 82435116 missense possibly damaging 0.89
IGL02592:Tmem132e APN 11 82434636 missense probably damaging 1.00
R0029:Tmem132e UTSW 11 82444761 missense probably damaging 1.00
R0501:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R0612:Tmem132e UTSW 11 82443372 missense probably damaging 1.00
R0613:Tmem132e UTSW 11 82438338 missense probably damaging 1.00
R1311:Tmem132e UTSW 11 82444296 missense probably damaging 1.00
R1430:Tmem132e UTSW 11 82438296 missense probably damaging 1.00
R1607:Tmem132e UTSW 11 82437370 missense probably benign 0.39
R1710:Tmem132e UTSW 11 82443517 missense probably damaging 1.00
R1913:Tmem132e UTSW 11 82443417 missense probably damaging 1.00
R1951:Tmem132e UTSW 11 82445082 missense possibly damaging 0.84
R2018:Tmem132e UTSW 11 82445163 missense probably benign 0.26
R2051:Tmem132e UTSW 11 82440438 missense probably damaging 1.00
R2076:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R2325:Tmem132e UTSW 11 82434515 missense probably damaging 1.00
R2924:Tmem132e UTSW 11 82444323 missense probably damaging 1.00
R3436:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R3437:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R4594:Tmem132e UTSW 11 82435068 missense possibly damaging 0.83
R4704:Tmem132e UTSW 11 82443531 missense probably damaging 0.97
R4754:Tmem132e UTSW 11 82444851 nonsense probably null
R4764:Tmem132e UTSW 11 82434512 missense probably damaging 0.99
R5245:Tmem132e UTSW 11 82442638 missense probably damaging 0.96
R5720:Tmem132e UTSW 11 82442450 splice site probably null
R5793:Tmem132e UTSW 11 82444858 missense probably damaging 1.00
R5984:Tmem132e UTSW 11 82445097 missense probably damaging 1.00
R6980:Tmem132e UTSW 11 82438386 critical splice donor site probably null
R7052:Tmem132e UTSW 11 82437363 missense probably damaging 0.99
R7637:Tmem132e UTSW 11 82434516 missense probably damaging 1.00
R7918:Tmem132e UTSW 11 82445290 missense probably damaging 1.00
R8262:Tmem132e UTSW 11 82434840 missense probably benign 0.33
R8772:Tmem132e UTSW 11 82434311 missense probably damaging 0.99
Z1177:Tmem132e UTSW 11 82435178 missense probably damaging 1.00
Z1177:Tmem132e UTSW 11 82445104 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTACAGTGATGGAACCACAG -3'
(R):5'- CAAGTAGTCCTCTGTGGGTG -3'

Sequencing Primer
(F):5'- TGTACAGTTCCCGGGACTAC -3'
(R):5'- CCTCTGTGGGTGGCACTG -3'
Posted On2014-09-18