Incidental Mutation 'R2100:Thrb'
ID230457
Institutional Source Beutler Lab
Gene Symbol Thrb
Ensembl Gene ENSMUSG00000021779
Gene Namethyroid hormone receptor beta
Synonymsc-erbAbeta, T3R[b], Nr1a2, T3Rbeta, Thrb1, TR beta, Thrb2
MMRRC Submission 040104-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R2100 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location17660261-18038090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18030393 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 379 (M379K)
Ref Sequence ENSEMBL: ENSMUSP00000089053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000022304] [ENSMUST00000091471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022303
AA Change: M379K

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779
AA Change: M379K

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022304
AA Change: M393K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022304
Gene: ENSMUSG00000021779
AA Change: M393K

DomainStartEndE-ValueType
ZnF_C4 118 191 2.88e-36 SMART
low complexity region 202 217 N/A INTRINSIC
HOLI 288 446 9.29e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091471
AA Change: M379K

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779
AA Change: M379K

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,500,249 N238S probably damaging Het
Abca3 C T 17: 24,408,209 R1295W probably damaging Het
Abca8b A T 11: 109,937,782 I1430N probably damaging Het
Abcb1a A G 5: 8,713,202 T577A probably damaging Het
Arl5b G A 2: 15,073,195 M101I probably benign Het
C1qbp T A 11: 70,978,102 N278I probably benign Het
Cdh1 A T 8: 106,659,668 T408S possibly damaging Het
Cfap54 T A 10: 93,001,937 I1034F possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Chil4 T C 3: 106,214,347 K62R probably benign Het
Crebl2 A G 6: 134,851,203 T113A probably benign Het
Cyp2c69 C A 19: 39,886,686 V8L probably benign Het
Dpp6 A G 5: 27,664,744 R447G probably damaging Het
Efcab6 A T 15: 83,892,967 probably null Het
Emilin1 T G 5: 30,917,897 V494G probably benign Het
Enoph1 A G 5: 100,063,786 I181V probably null Het
F3 T C 3: 121,732,433 V215A possibly damaging Het
Fat3 G T 9: 16,377,430 H266N possibly damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Garnl3 T C 2: 33,046,645 T171A probably benign Het
Hspa4l T C 3: 40,772,658 V476A possibly damaging Het
Impg2 A G 16: 56,231,385 probably null Het
Kctd6 T C 14: 8,222,239 L27P possibly damaging Het
Kmt2d G T 15: 98,846,480 probably benign Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,201,788 probably benign Het
Lrig2 A G 3: 104,511,630 L21P possibly damaging Het
Macf1 G A 4: 123,397,906 Q3284* probably null Het
Mnt A G 11: 74,831,351 E8G probably damaging Het
Nbeal1 A G 1: 60,305,271 probably null Het
Nid2 C T 14: 19,778,878 Q331* probably null Het
Nlrx1 A G 9: 44,262,608 L432P probably damaging Het
Nop2 T A 6: 125,140,822 D445E probably damaging Het
Nup62 T C 7: 44,829,497 probably benign Het
Oas2 A G 5: 120,745,675 probably null Het
Olfr1090 A T 2: 86,754,561 M59K possibly damaging Het
Olfr1128 T A 2: 87,544,825 T240S probably damaging Het
Olfr1480 A G 19: 13,530,434 I298V probably benign Het
Olfr1499 A G 19: 13,815,236 M118T possibly damaging Het
Olfr491 A T 7: 108,317,554 Y220F probably benign Het
P3h3 T A 6: 124,845,042 T623S probably damaging Het
Pkp3 T C 7: 141,083,292 V350A probably damaging Het
Plekha3 T A 2: 76,692,663 I225N probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf213 A T 11: 119,467,302 K4292* probably null Het
Rtkn T C 6: 83,149,560 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Snx10 T C 6: 51,588,415 Y171H probably damaging Het
Stx12 A T 4: 132,860,602 I173N possibly damaging Het
Tmem132e T A 11: 82,444,531 V813E probably damaging Het
Tnfsf12 T C 11: 69,687,349 E134G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpbgl T A 7: 99,626,444 I69F possibly damaging Het
Ythdc1 T A 5: 86,816,685 S130T possibly damaging Het
Zbp1 A G 2: 173,209,244 S278P probably damaging Het
Zfp30 A G 7: 29,793,526 T483A probably benign Het
Zfp322a G A 13: 23,357,290 S94L possibly damaging Het
Zfp646 T G 7: 127,882,187 Y1179D probably damaging Het
Other mutations in Thrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Thrb APN 14 18011056 splice site probably benign
IGL02488:Thrb APN 14 18033455 missense probably damaging 0.98
IGL02598:Thrb APN 14 18008606 missense possibly damaging 0.95
IGL02707:Thrb APN 14 18026721 missense probably benign 0.42
harry UTSW 14 18011145 nonsense probably null
R0479:Thrb UTSW 14 18033643 missense probably damaging 0.99
R0988:Thrb UTSW 14 17981837 intron probably benign
R1257:Thrb UTSW 14 18008642 missense probably damaging 1.00
R1522:Thrb UTSW 14 18002597 missense probably damaging 1.00
R1927:Thrb UTSW 14 18008674 missense probably damaging 1.00
R2134:Thrb UTSW 14 18033487 missense probably benign 0.22
R3551:Thrb UTSW 14 17963214 missense probably damaging 0.99
R3888:Thrb UTSW 14 18033551 missense probably damaging 1.00
R3975:Thrb UTSW 14 18033456 missense probably damaging 1.00
R4294:Thrb UTSW 14 18011145 nonsense probably null
R4371:Thrb UTSW 14 18030275 missense probably damaging 1.00
R4454:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4457:Thrb UTSW 14 18011187 missense probably damaging 0.97
R4486:Thrb UTSW 14 17925640 start codon destroyed probably null 0.72
R4961:Thrb UTSW 14 18011076 missense probably benign 0.39
R5184:Thrb UTSW 14 18011181 nonsense probably null
R5609:Thrb UTSW 14 18033526 missense probably benign 0.22
R6023:Thrb UTSW 14 18011209 missense probably damaging 0.98
R6891:Thrb UTSW 14 17981899 missense probably benign
R7288:Thrb UTSW 14 18030186 missense probably damaging 1.00
R7294:Thrb UTSW 14 17826963 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATCCTCCTCAAAGGCTGCTG -3'
(R):5'- AGCTCTCTGTCAATTGACCC -3'

Sequencing Primer
(F):5'- CATGGAGATCATGTCCCTTCGAG -3'
(R):5'- ACCCTTCTAGTTTCTGGATGCAAGAG -3'
Posted On2014-09-18