Incidental Mutation 'R2100:Rbp3'
ID230459
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 040104-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R2100 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33956018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 641 (T641M)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: T641M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: T641M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,500,249 N238S probably damaging Het
Abca3 C T 17: 24,408,209 R1295W probably damaging Het
Abca8b A T 11: 109,937,782 I1430N probably damaging Het
Abcb1a A G 5: 8,713,202 T577A probably damaging Het
Arl5b G A 2: 15,073,195 M101I probably benign Het
C1qbp T A 11: 70,978,102 N278I probably benign Het
Cdh1 A T 8: 106,659,668 T408S possibly damaging Het
Cfap54 T A 10: 93,001,937 I1034F possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Chil4 T C 3: 106,214,347 K62R probably benign Het
Crebl2 A G 6: 134,851,203 T113A probably benign Het
Cyp2c69 C A 19: 39,886,686 V8L probably benign Het
Dpp6 A G 5: 27,664,744 R447G probably damaging Het
Efcab6 A T 15: 83,892,967 probably null Het
Emilin1 T G 5: 30,917,897 V494G probably benign Het
Enoph1 A G 5: 100,063,786 I181V probably null Het
F3 T C 3: 121,732,433 V215A possibly damaging Het
Fat3 G T 9: 16,377,430 H266N possibly damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Garnl3 T C 2: 33,046,645 T171A probably benign Het
Hspa4l T C 3: 40,772,658 V476A possibly damaging Het
Impg2 A G 16: 56,231,385 probably null Het
Kctd6 T C 14: 8,222,239 L27P possibly damaging Het
Kmt2d G T 15: 98,846,480 probably benign Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,201,788 probably benign Het
Lrig2 A G 3: 104,511,630 L21P possibly damaging Het
Macf1 G A 4: 123,397,906 Q3284* probably null Het
Mnt A G 11: 74,831,351 E8G probably damaging Het
Nbeal1 A G 1: 60,305,271 probably null Het
Nid2 C T 14: 19,778,878 Q331* probably null Het
Nlrx1 A G 9: 44,262,608 L432P probably damaging Het
Nop2 T A 6: 125,140,822 D445E probably damaging Het
Nup62 T C 7: 44,829,497 probably benign Het
Oas2 A G 5: 120,745,675 probably null Het
Olfr1090 A T 2: 86,754,561 M59K possibly damaging Het
Olfr1128 T A 2: 87,544,825 T240S probably damaging Het
Olfr1480 A G 19: 13,530,434 I298V probably benign Het
Olfr1499 A G 19: 13,815,236 M118T possibly damaging Het
Olfr491 A T 7: 108,317,554 Y220F probably benign Het
P3h3 T A 6: 124,845,042 T623S probably damaging Het
Pkp3 T C 7: 141,083,292 V350A probably damaging Het
Plekha3 T A 2: 76,692,663 I225N probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf213 A T 11: 119,467,302 K4292* probably null Het
Rtkn T C 6: 83,149,560 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Snx10 T C 6: 51,588,415 Y171H probably damaging Het
Stx12 A T 4: 132,860,602 I173N possibly damaging Het
Thrb T A 14: 18,030,393 M379K possibly damaging Het
Tmem132e T A 11: 82,444,531 V813E probably damaging Het
Tnfsf12 T C 11: 69,687,349 E134G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpbgl T A 7: 99,626,444 I69F possibly damaging Het
Ythdc1 T A 5: 86,816,685 S130T possibly damaging Het
Zbp1 A G 2: 173,209,244 S278P probably damaging Het
Zfp30 A G 7: 29,793,526 T483A probably benign Het
Zfp322a G A 13: 23,357,290 S94L possibly damaging Het
Zfp646 T G 7: 127,882,187 Y1179D probably damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTTTGCCTTCCTCATGC -3'
(R):5'- TCCCCAGGGCTATGGAATAC -3'

Sequencing Primer
(F):5'- ACTGGTCGGCGAAATCAC -3'
(R):5'- TGGAATACCAGCAGGCGGTG -3'
Posted On2014-09-18