Incidental Mutation 'R2101:Astn2'
ID230488
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Nameastrotactin 2
Synonyms1d8, Astnl
MMRRC Submission 040105-MU
Accession Numbers

Genbank: NM_019514.3, NM_207109.2; Ensembl: ENSMUST00000068214,   ENSMUST00000084496

Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2101 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location65380803-66404611 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 65581686 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 937 (R937*)
Ref Sequence ENSEMBL: ENSMUSP00000081540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
Predicted Effect probably null
Transcript: ENSMUST00000068214
AA Change: R989*
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: R989*

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084496
AA Change: R937*
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: R937*

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G A 2: 103,566,862 A46T probably benign Het
Agap3 T A 5: 24,487,799 L47Q probably damaging Het
Apaf1 T G 10: 91,060,080 I377L probably benign Het
Cacnb1 A C 11: 98,005,728 V369G probably damaging Het
Cdc42bpa G T 1: 180,146,968 V1464L probably benign Het
Cdkn2aip A T 8: 47,713,001 M90K probably damaging Het
Chd3 A T 11: 69,349,051 D1650E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca2 T C 3: 145,077,938 T639A probably damaging Het
Cluh G T 11: 74,660,502 probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Col11a2 A T 17: 34,052,169 D528V probably damaging Het
Cyfip2 A G 11: 46,242,443 L810P probably damaging Het
D430041D05Rik A G 2: 104,148,830 V2084A probably damaging Het
Dcc G A 18: 71,810,870 H237Y possibly damaging Het
Ddx60 T A 8: 61,940,645 F38L probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dock5 G T 14: 67,794,010 F990L probably benign Het
Dpy19l1 A T 9: 24,482,035 V146E probably damaging Het
Dscam T C 16: 96,610,349 T1776A probably benign Het
Enpep C T 3: 129,298,938 S532N probably benign Het
Gdf6 A G 4: 9,860,025 D369G probably damaging Het
Gm6169 G T 13: 97,099,222 R6S probably damaging Het
Gtf2b T C 3: 142,771,383 probably benign Het
Hmbox1 A G 14: 64,828,579 probably benign Het
Hps3 C A 3: 20,012,783 V540F possibly damaging Het
Hsd3b6 T A 3: 98,806,237 I249F possibly damaging Het
Hunk T A 16: 90,432,500 probably null Het
Kidins220 T A 12: 25,057,423 L1625Q probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Myo10 T A 15: 25,722,259 L186Q probably benign Het
N4bp2 T A 5: 65,790,881 W285R probably damaging Het
Nat8l T C 5: 33,998,372 L124P probably damaging Het
Nemp2 T C 1: 52,641,066 probably null Het
Nkain2 G A 10: 32,329,817 T74I possibly damaging Het
Nol4 A G 18: 22,823,409 S239P probably damaging Het
Olfr1223 T A 2: 89,144,957 E22V probably benign Het
Pcbp3 T C 10: 76,789,755 I152V possibly damaging Het
Pcp4l1 G T 1: 171,175,605 P10Q probably damaging Het
Pla1a T C 16: 38,415,368 N135D probably damaging Het
Plb1 T A 5: 32,349,660 M1193K probably damaging Het
Prc1 T C 7: 80,312,284 V73A probably benign Het
Prkd2 T A 7: 16,869,565 W807R probably damaging Het
Ptprb C T 10: 116,315,038 probably benign Het
Rb1cc1 A G 1: 6,249,335 I993V probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rev3l T C 10: 39,828,096 V2046A probably benign Het
Rnpep G T 1: 135,271,617 N334K probably damaging Het
Sarm1 G A 11: 78,475,289 P695S probably damaging Het
Sf3a3 C T 4: 124,718,343 T131I possibly damaging Het
Slc38a10 A T 11: 120,132,741 V283E probably damaging Het
Slco6c1 A T 1: 97,072,870 L552* probably null Het
Tas2r136 T C 6: 132,777,532 M211V probably benign Het
Tax1bp3 G A 11: 73,181,121 D65N probably damaging Het
Tdrd5 A G 1: 156,301,639 F167S probably damaging Het
Tfeb G A 17: 47,789,665 V269M probably damaging Het
Tspan12 A T 6: 21,799,888 F153L probably benign Het
Txnrd1 T G 10: 82,881,739 L186V probably damaging Het
Upk1b A T 16: 38,780,137 C160* probably null Het
Uty T C Y: 1,176,541 Q172R probably damaging Het
Vmn1r23 T C 6: 57,926,452 K114E possibly damaging Het
Vmn2r99 T G 17: 19,377,991 N92K probably damaging Het
Vstm2a T A 11: 16,263,191 M192K probably benign Het
Zc3h12c A G 9: 52,116,421 V547A probably benign Het
Zfp944 T A 17: 22,339,828 N146I probably benign Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66185187 missense unknown
IGL01657:Astn2 APN 4 65651949 missense probably damaging 0.99
IGL01747:Astn2 APN 4 65794618 missense probably benign 0.17
IGL02008:Astn2 APN 4 66059153 missense probably damaging 1.00
IGL02215:Astn2 APN 4 66266234 missense unknown
IGL02484:Astn2 APN 4 65992279 splice site probably benign
IGL02494:Astn2 APN 4 65992348 missense probably benign 0.23
IGL02792:Astn2 APN 4 65644821 missense probably benign 0.32
IGL03248:Astn2 APN 4 65746293 splice site probably benign
IGL03409:Astn2 APN 4 65435186 missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65992387 missense probably damaging 0.99
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0015:Astn2 UTSW 4 66266382 critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66403982 missense unknown
R0245:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0528:Astn2 UTSW 4 65644882 splice site probably benign
R0586:Astn2 UTSW 4 66185142 missense unknown
R0652:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R0880:Astn2 UTSW 4 65648330 missense probably damaging 0.99
R0931:Astn2 UTSW 4 65648293 missense probably damaging 0.99
R1353:Astn2 UTSW 4 66266335 missense unknown
R1700:Astn2 UTSW 4 65746354 nonsense probably null
R1934:Astn2 UTSW 4 65435189 missense probably damaging 0.99
R2017:Astn2 UTSW 4 65540941 missense probably damaging 0.99
R2158:Astn2 UTSW 4 66404254 missense unknown
R2907:Astn2 UTSW 4 65644856 missense possibly damaging 0.92
R2923:Astn2 UTSW 4 65913773 missense probably damaging 1.00
R2938:Astn2 UTSW 4 65992313 missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65644706 missense probably damaging 1.00
R3933:Astn2 UTSW 4 66403955 missense unknown
R4151:Astn2 UTSW 4 65729320 critical splice donor site probably null
R4230:Astn2 UTSW 4 65911682 missense probably damaging 0.99
R4497:Astn2 UTSW 4 66119063 intron probably benign
R4717:Astn2 UTSW 4 65644754 missense possibly damaging 0.86
R4844:Astn2 UTSW 4 65644730 missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65729407 missense probably damaging 0.98
R5374:Astn2 UTSW 4 65397005 missense probably damaging 0.96
R5442:Astn2 UTSW 4 65581786 missense possibly damaging 0.86
R5694:Astn2 UTSW 4 65950138 missense probably damaging 1.00
R5756:Astn2 UTSW 4 66119188 intron probably benign
R5763:Astn2 UTSW 4 65729331 missense probably benign 0.14
R6089:Astn2 UTSW 4 65794573 missense probably damaging 0.96
R6990:Astn2 UTSW 4 65992303 missense possibly damaging 0.82
R7304:Astn2 UTSW 4 66185375 missense unknown
R7325:Astn2 UTSW 4 65542669 missense probably benign 0.33
R7356:Astn2 UTSW 4 66185266 missense unknown
R7414:Astn2 UTSW 4 65540956 missense possibly damaging 0.85
R7755:Astn2 UTSW 4 65794558 missense probably damaging 0.99
R7887:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R7970:Astn2 UTSW 4 65644866 missense possibly damaging 0.51
R8027:Astn2 UTSW 4 65540971 missense possibly damaging 0.86
R8046:Astn2 UTSW 4 66266350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATGTGACTATCTGGGCCAG -3'
(R):5'- AGGTACCAGTCTCTCAGTGAATG -3'

Sequencing Primer
(F):5'- AGGGAAGCTCACCTCCTTTGTG -3'
(R):5'- TGGCCTAGAGATTCAGCCACTTAG -3'
Posted On2014-09-18