Incidental Mutation 'R0179:Golga4'
ID 23049
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 038447-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0179 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 118389808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000211846] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably null
Transcript: ENSMUST00000084820
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000211840
Predicted Effect probably benign
Transcript: ENSMUST00000211846
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212151
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Meta Mutation Damage Score 0.9578 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 C T 16: 85,592,353 (GRCm39) S948N probably benign Het
Adck1 A T 12: 88,425,942 (GRCm39) M457L possibly damaging Het
Adprm A T 11: 66,929,051 (GRCm39) H313Q possibly damaging Het
Adss1 T C 12: 112,598,703 (GRCm39) I104T probably benign Het
Agxt2 A C 15: 10,399,134 (GRCm39) Q435P possibly damaging Het
Amotl1 G A 9: 14,460,069 (GRCm39) A890V probably benign Het
Ankrd50 A G 3: 38,509,463 (GRCm39) V968A possibly damaging Het
Brf2 T C 8: 27,615,896 (GRCm39) D163G possibly damaging Het
Cd226 C A 18: 89,225,263 (GRCm39) N53K probably benign Het
Cdc42ep2 T C 19: 5,968,636 (GRCm39) D23G probably benign Het
Cdc7 T C 5: 107,112,905 (GRCm39) S8P probably benign Het
Cdh8 C T 8: 99,838,344 (GRCm39) E499K possibly damaging Het
Chd7 T A 4: 8,862,516 (GRCm39) F2534L probably benign Het
Ckb T C 12: 111,636,610 (GRCm39) T255A probably benign Het
Cntnap5c G T 17: 58,076,620 (GRCm39) W19L probably benign Het
Cntrl A G 2: 35,057,871 (GRCm39) E1854G probably benign Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cop1 A G 1: 159,077,636 (GRCm39) D157G probably benign Het
Csf2rb A C 15: 78,220,572 (GRCm39) Q38P possibly damaging Het
Ctla2b T C 13: 61,044,107 (GRCm39) D52G possibly damaging Het
Dcaf7 A T 11: 105,942,623 (GRCm39) D190V probably damaging Het
Depdc5 T A 5: 33,058,918 (GRCm39) probably benign Het
Dgkq A G 5: 108,806,066 (GRCm39) probably benign Het
Dhrs2 A G 14: 55,477,933 (GRCm39) T222A probably damaging Het
Dock1 G A 7: 134,700,566 (GRCm39) D1109N probably damaging Het
E4f1 G C 17: 24,670,411 (GRCm39) T92S possibly damaging Het
Ep400 A T 5: 110,816,515 (GRCm39) S2669T probably damaging Het
Eprs1 T G 1: 185,145,744 (GRCm39) D1184E probably benign Het
Fpr-rs4 A T 17: 18,242,289 (GRCm39) K99* probably null Het
Fzr1 A T 10: 81,204,904 (GRCm39) probably benign Het
Gcc2 C T 10: 58,112,472 (GRCm39) R1001C probably benign Het
Gm4884 A G 7: 40,693,252 (GRCm39) D407G probably benign Het
Gp2 T G 7: 119,051,540 (GRCm39) D225A possibly damaging Het
Gramd1a T A 7: 30,841,843 (GRCm39) T120S probably damaging Het
Hbb-bh2 T A 7: 103,488,434 (GRCm39) N121I probably benign Het
Htr6 A T 4: 138,789,437 (GRCm39) L276Q probably damaging Het
Itga9 A T 9: 118,490,454 (GRCm39) I262F probably benign Het
Lamc3 A G 2: 31,805,096 (GRCm39) probably benign Het
Large1 T C 8: 73,825,474 (GRCm39) N200S probably benign Het
Lct C T 1: 128,255,422 (GRCm39) V207I probably benign Het
Marf1 C A 16: 13,969,040 (GRCm39) L144F probably damaging Het
Morc2b A T 17: 33,355,956 (GRCm39) Y605* probably null Het
Mtus1 G T 8: 41,455,398 (GRCm39) L87I possibly damaging Het
Muc2 A G 7: 141,302,708 (GRCm39) Y17C probably damaging Het
Myf5 T C 10: 107,321,779 (GRCm39) D5G possibly damaging Het
Nasp C T 4: 116,459,354 (GRCm39) V375M probably damaging Het
Nr1h2 A T 7: 44,201,689 (GRCm39) probably null Het
Nrg2 T C 18: 36,155,468 (GRCm39) Q447R probably benign Het
Ntn5 G A 7: 45,335,737 (GRCm39) G56D probably damaging Het
Oasl2 A G 5: 115,048,973 (GRCm39) R138G probably benign Het
Or4c29 A T 2: 88,740,237 (GRCm39) C167S possibly damaging Het
Or5b124 T A 19: 13,610,504 (GRCm39) F10I probably damaging Het
Or9k7 T C 10: 130,046,207 (GRCm39) Y264C probably damaging Het
Pcdhb5 G A 18: 37,455,612 (GRCm39) G664D probably damaging Het
Ppp1r15a T C 7: 45,174,424 (GRCm39) E128G probably damaging Het
Prpf19 T C 19: 10,875,172 (GRCm39) probably benign Het
Ptpn3 T A 4: 57,270,118 (GRCm39) T15S probably benign Het
R3hdm2 G A 10: 127,330,975 (GRCm39) C818Y probably damaging Het
Rad51d A G 11: 82,780,824 (GRCm39) V39A possibly damaging Het
Rptor A T 11: 119,763,193 (GRCm39) T926S probably benign Het
Rwdd4a G A 8: 47,995,742 (GRCm39) D41N probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Spata31g1 T C 4: 42,972,214 (GRCm39) S516P probably benign Het
Ssbp3 T C 4: 106,903,585 (GRCm39) S334P probably damaging Het
Suco A G 1: 161,703,874 (GRCm39) probably benign Het
Synj1 T C 16: 90,761,519 (GRCm39) K649R possibly damaging Het
Tdp2 C T 13: 25,024,431 (GRCm39) H243Y possibly damaging Het
Tinag A G 9: 76,904,164 (GRCm39) probably benign Het
Trerf1 T C 17: 47,627,588 (GRCm39) noncoding transcript Het
Trip10 T C 17: 57,569,349 (GRCm39) probably benign Het
Tsen54 A T 11: 115,712,856 (GRCm39) S131C probably damaging Het
Unc5c A T 3: 141,523,828 (GRCm39) R794* probably null Het
Vmn2r59 A T 7: 41,696,432 (GRCm39) Y103* probably null Het
Washc5 A G 15: 59,224,379 (GRCm39) V460A probably benign Het
Wdr87-ps A G 7: 29,235,365 (GRCm39) noncoding transcript Het
Whamm A G 7: 81,243,763 (GRCm39) T358A probably benign Het
Xlr4b C T X: 72,262,277 (GRCm39) probably benign Het
Zbbx C T 3: 74,992,869 (GRCm39) probably benign Het
Zdhhc23 G A 16: 43,794,066 (GRCm39) P203S probably benign Het
Zfp27 T A 7: 29,595,850 (GRCm39) E38D possibly damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGGAAAACGGTCCTTGTCCAGAAAG -3'
(R):5'- GCTGCACTTGCTCCCAGACTTAAC -3'

Sequencing Primer
(F):5'- GCACTTGTCCTCCTGAACG -3'
(R):5'- TCTCTCCATGTGAGAAGCCAG -3'
Posted On 2013-04-16