Incidental Mutation 'R2101:Vmn1r23'
ID230496
Institutional Source Beutler Lab
Gene Symbol Vmn1r23
Ensembl Gene ENSMUSG00000093376
Gene Namevomeronasal 1 receptor 23
SynonymsV1rc24
MMRRC Submission 040105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2101 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57925842-57926838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57926452 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 114 (K114E)
Ref Sequence ENSEMBL: ENSMUSP00000135676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000175817
AA Change: K114E

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135676
Gene: ENSMUSG00000093376
AA Change: K114E

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.1e-57 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G A 2: 103,566,862 A46T probably benign Het
Agap3 T A 5: 24,487,799 L47Q probably damaging Het
Apaf1 T G 10: 91,060,080 I377L probably benign Het
Astn2 G A 4: 65,581,686 R937* probably null Het
Cacnb1 A C 11: 98,005,728 V369G probably damaging Het
Cdc42bpa G T 1: 180,146,968 V1464L probably benign Het
Cdkn2aip A T 8: 47,713,001 M90K probably damaging Het
Chd3 A T 11: 69,349,051 D1650E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca2 T C 3: 145,077,938 T639A probably damaging Het
Cluh G T 11: 74,660,502 probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Col11a2 A T 17: 34,052,169 D528V probably damaging Het
Cyfip2 A G 11: 46,242,443 L810P probably damaging Het
D430041D05Rik A G 2: 104,148,830 V2084A probably damaging Het
Dcc G A 18: 71,810,870 H237Y possibly damaging Het
Ddx60 T A 8: 61,940,645 F38L probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dock5 G T 14: 67,794,010 F990L probably benign Het
Dpy19l1 A T 9: 24,482,035 V146E probably damaging Het
Dscam T C 16: 96,610,349 T1776A probably benign Het
Enpep C T 3: 129,298,938 S532N probably benign Het
Gdf6 A G 4: 9,860,025 D369G probably damaging Het
Gm6169 G T 13: 97,099,222 R6S probably damaging Het
Gtf2b T C 3: 142,771,383 probably benign Het
Hmbox1 A G 14: 64,828,579 probably benign Het
Hps3 C A 3: 20,012,783 V540F possibly damaging Het
Hsd3b6 T A 3: 98,806,237 I249F possibly damaging Het
Hunk T A 16: 90,432,500 probably null Het
Kidins220 T A 12: 25,057,423 L1625Q probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Myo10 T A 15: 25,722,259 L186Q probably benign Het
N4bp2 T A 5: 65,790,881 W285R probably damaging Het
Nat8l T C 5: 33,998,372 L124P probably damaging Het
Nemp2 T C 1: 52,641,066 probably null Het
Nkain2 G A 10: 32,329,817 T74I possibly damaging Het
Nol4 A G 18: 22,823,409 S239P probably damaging Het
Olfr1223 T A 2: 89,144,957 E22V probably benign Het
Pcbp3 T C 10: 76,789,755 I152V possibly damaging Het
Pcp4l1 G T 1: 171,175,605 P10Q probably damaging Het
Pla1a T C 16: 38,415,368 N135D probably damaging Het
Plb1 T A 5: 32,349,660 M1193K probably damaging Het
Prc1 T C 7: 80,312,284 V73A probably benign Het
Prkd2 T A 7: 16,869,565 W807R probably damaging Het
Ptprb C T 10: 116,315,038 probably benign Het
Rb1cc1 A G 1: 6,249,335 I993V probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rev3l T C 10: 39,828,096 V2046A probably benign Het
Rnpep G T 1: 135,271,617 N334K probably damaging Het
Sarm1 G A 11: 78,475,289 P695S probably damaging Het
Sf3a3 C T 4: 124,718,343 T131I possibly damaging Het
Slc38a10 A T 11: 120,132,741 V283E probably damaging Het
Slco6c1 A T 1: 97,072,870 L552* probably null Het
Tas2r136 T C 6: 132,777,532 M211V probably benign Het
Tax1bp3 G A 11: 73,181,121 D65N probably damaging Het
Tdrd5 A G 1: 156,301,639 F167S probably damaging Het
Tfeb G A 17: 47,789,665 V269M probably damaging Het
Tspan12 A T 6: 21,799,888 F153L probably benign Het
Txnrd1 T G 10: 82,881,739 L186V probably damaging Het
Upk1b A T 16: 38,780,137 C160* probably null Het
Uty T C Y: 1,176,541 Q172R probably damaging Het
Vmn2r99 T G 17: 19,377,991 N92K probably damaging Het
Vstm2a T A 11: 16,263,191 M192K probably benign Het
Zc3h12c A G 9: 52,116,421 V547A probably benign Het
Zfp944 T A 17: 22,339,828 N146I probably benign Het
Other mutations in Vmn1r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Vmn1r23 APN 6 57926076 missense possibly damaging 0.89
IGL01980:Vmn1r23 APN 6 57926490 missense probably damaging 1.00
IGL02934:Vmn1r23 APN 6 57925929 missense probably benign 0.26
IGL03153:Vmn1r23 APN 6 57925932 missense probably damaging 0.98
R0410:Vmn1r23 UTSW 6 57926190 missense probably benign 0.11
R0452:Vmn1r23 UTSW 6 57926484 missense possibly damaging 0.90
R0590:Vmn1r23 UTSW 6 57926364 missense probably benign 0.43
R0647:Vmn1r23 UTSW 6 57926184 missense probably benign
R0692:Vmn1r23 UTSW 6 57926125 nonsense probably null
R1674:Vmn1r23 UTSW 6 57926061 missense possibly damaging 0.75
R1744:Vmn1r23 UTSW 6 57925925 missense possibly damaging 0.81
R1774:Vmn1r23 UTSW 6 57926690 missense probably damaging 0.97
R2202:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2204:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R2205:Vmn1r23 UTSW 6 57926619 missense probably benign 0.01
R4282:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R4408:Vmn1r23 UTSW 6 57926368 missense probably benign 0.01
R4532:Vmn1r23 UTSW 6 57925929 missense probably benign 0.21
R4690:Vmn1r23 UTSW 6 57926025 missense probably benign
R4700:Vmn1r23 UTSW 6 57926205 missense probably benign 0.17
R4894:Vmn1r23 UTSW 6 57926325 missense probably benign 0.00
R6164:Vmn1r23 UTSW 6 57926055 missense possibly damaging 0.90
R6930:Vmn1r23 UTSW 6 57926145 missense probably benign
R7129:Vmn1r23 UTSW 6 57926076 missense possibly damaging 0.89
R7731:Vmn1r23 UTSW 6 57926334 missense probably benign 0.03
R7877:Vmn1r23 UTSW 6 57926556 missense probably benign
R8751:Vmn1r23 UTSW 6 57926467 missense probably benign 0.27
R8809:Vmn1r23 UTSW 6 57926367 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGTGGTCAGCATGACTCCTAC -3'
(R):5'- GCAGGAGATAATTGGTTTACAGAC -3'

Sequencing Primer
(F):5'- TGGTCAGCATGACTCCTACAAGAAAC -3'
(R):5'- GGTTTACAGACTTATTTGAGTCACTG -3'
Posted On2014-09-18