Mutagenetix > Incidental Mutation

Incidental Mutation 'R2101:Ddx60'

230502

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

040105-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R2101 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61940645 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 38 (F38L)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398] [ENSMUST00000156980]

AlphaFold

E9PZQ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000070631
AA Change: F38L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: F38L

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000093485
AA Change: F38L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: F38L

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000154398
AA Change: F38L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: F38L

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156980
AA Change: F38L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.5776

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	G	A	2: 103,566,862	A46T	probably benign	Het
Agap3	T	A	5: 24,487,799	L47Q	probably damaging	Het
Apaf1	T	G	10: 91,060,080	I377L	probably benign	Het
Astn2	G	A	4: 65,581,686	R937*	probably null	Het
Cacnb1	A	C	11: 98,005,728	V369G	probably damaging	Het
Cdc42bpa	G	T	1: 180,146,968	V1464L	probably benign	Het
Cdkn2aip	A	T	8: 47,713,001	M90K	probably damaging	Het
Chd3	A	T	11: 69,349,051	D1650E	probably benign	Het
Chd9	C	T	8: 91,033,987	P2120L	probably benign	Het
Clca2	T	C	3: 145,077,938	T639A	probably damaging	Het
Cluh	G	T	11: 74,660,502		probably benign	Het
Cnga1	C	T	5: 72,619,061	V20I	possibly damaging	Het
Col11a2	A	T	17: 34,052,169	D528V	probably damaging	Het
Cyfip2	A	G	11: 46,242,443	L810P	probably damaging	Het
D430041D05Rik	A	G	2: 104,148,830	V2084A	probably damaging	Het
Dcc	G	A	18: 71,810,870	H237Y	possibly damaging	Het
Dio2	T	C	12: 90,729,823	*130W	probably null	Het
Dock5	G	T	14: 67,794,010	F990L	probably benign	Het
Dpy19l1	A	T	9: 24,482,035	V146E	probably damaging	Het
Dscam	T	C	16: 96,610,349	T1776A	probably benign	Het
Enpep	C	T	3: 129,298,938	S532N	probably benign	Het
Gdf6	A	G	4: 9,860,025	D369G	probably damaging	Het
Gm6169	G	T	13: 97,099,222	R6S	probably damaging	Het
Gtf2b	T	C	3: 142,771,383		probably benign	Het
Hmbox1	A	G	14: 64,828,579		probably benign	Het
Hps3	C	A	3: 20,012,783	V540F	possibly damaging	Het
Hsd3b6	T	A	3: 98,806,237	I249F	possibly damaging	Het
Hunk	T	A	16: 90,432,500		probably null	Het
Kidins220	T	A	12: 25,057,423	L1625Q	probably damaging	Het
Krt1	C	T	15: 101,846,187	G543S	unknown	Het
Myo10	T	A	15: 25,722,259	L186Q	probably benign	Het
N4bp2	T	A	5: 65,790,881	W285R	probably damaging	Het
Nat8l	T	C	5: 33,998,372	L124P	probably damaging	Het
Nemp2	T	C	1: 52,641,066		probably null	Het
Nkain2	G	A	10: 32,329,817	T74I	possibly damaging	Het
Nol4	A	G	18: 22,823,409	S239P	probably damaging	Het
Olfr1223	T	A	2: 89,144,957	E22V	probably benign	Het
Pcbp3	T	C	10: 76,789,755	I152V	possibly damaging	Het
Pcp4l1	G	T	1: 171,175,605	P10Q	probably damaging	Het
Pla1a	T	C	16: 38,415,368	N135D	probably damaging	Het
Plb1	T	A	5: 32,349,660	M1193K	probably damaging	Het
Prc1	T	C	7: 80,312,284	V73A	probably benign	Het
Prkd2	T	A	7: 16,869,565	W807R	probably damaging	Het
Ptprb	C	T	10: 116,315,038		probably benign	Het
Rb1cc1	A	G	1: 6,249,335	I993V	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rev3l	T	C	10: 39,828,096	V2046A	probably benign	Het
Rnpep	G	T	1: 135,271,617	N334K	probably damaging	Het
Sarm1	G	A	11: 78,475,289	P695S	probably damaging	Het
Sf3a3	C	T	4: 124,718,343	T131I	possibly damaging	Het
Slc38a10	A	T	11: 120,132,741	V283E	probably damaging	Het
Slco6c1	A	T	1: 97,072,870	L552*	probably null	Het
Tas2r136	T	C	6: 132,777,532	M211V	probably benign	Het
Tax1bp3	G	A	11: 73,181,121	D65N	probably damaging	Het
Tdrd5	A	G	1: 156,301,639	F167S	probably damaging	Het
Tfeb	G	A	17: 47,789,665	V269M	probably damaging	Het
Tspan12	A	T	6: 21,799,888	F153L	probably benign	Het
Txnrd1	T	G	10: 82,881,739	L186V	probably damaging	Het
Upk1b	A	T	16: 38,780,137	C160*	probably null	Het
Uty	T	C	Y: 1,176,541	Q172R	probably damaging	Het
Vmn1r23	T	C	6: 57,926,452	K114E	possibly damaging	Het
Vmn2r99	T	G	17: 19,377,991	N92K	probably damaging	Het
Vstm2a	T	A	11: 16,263,191	M192K	probably benign	Het
Zc3h12c	A	G	9: 52,116,421	V547A	probably benign	Het
Zfp944	T	A	17: 22,339,828	N146I	probably benign	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
R9766:Ddx60	UTSW	8	62012278	missense	probably damaging	1.00
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CTTGGAAACTATGTCAAAGGCTGAG -3'
(R):5'- ACCCAGTTGGAATGTGTTACC -3'

Sequencing Primer
(F):5'- CTGCATCTGTCTCTATGGATAAAGAC -3'
(R):5'- CCCAGTTGGAATGTGTTACCTTGAAG -3'

Posted On

2014-09-18