Incidental Mutation 'R2101:Rev3l'
ID230508
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene NameREV3 like, DNA directed polymerase zeta catalytic subunit
SynonymsSez4, Rev
MMRRC Submission 040105-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2101 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39732118-39875211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39828096 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2046 (V2046A)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: V2046A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: V2046A

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
AA Change: V172A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841
AA Change: V172A

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145333
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: V2046A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: V2046A

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Meta Mutation Damage Score 0.0579 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G A 2: 103,566,862 A46T probably benign Het
Agap3 T A 5: 24,487,799 L47Q probably damaging Het
Apaf1 T G 10: 91,060,080 I377L probably benign Het
Astn2 G A 4: 65,581,686 R937* probably null Het
Cacnb1 A C 11: 98,005,728 V369G probably damaging Het
Cdc42bpa G T 1: 180,146,968 V1464L probably benign Het
Cdkn2aip A T 8: 47,713,001 M90K probably damaging Het
Chd3 A T 11: 69,349,051 D1650E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca2 T C 3: 145,077,938 T639A probably damaging Het
Cluh G T 11: 74,660,502 probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Col11a2 A T 17: 34,052,169 D528V probably damaging Het
Cyfip2 A G 11: 46,242,443 L810P probably damaging Het
D430041D05Rik A G 2: 104,148,830 V2084A probably damaging Het
Dcc G A 18: 71,810,870 H237Y possibly damaging Het
Ddx60 T A 8: 61,940,645 F38L probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dock5 G T 14: 67,794,010 F990L probably benign Het
Dpy19l1 A T 9: 24,482,035 V146E probably damaging Het
Dscam T C 16: 96,610,349 T1776A probably benign Het
Enpep C T 3: 129,298,938 S532N probably benign Het
Gdf6 A G 4: 9,860,025 D369G probably damaging Het
Gm6169 G T 13: 97,099,222 R6S probably damaging Het
Gtf2b T C 3: 142,771,383 probably benign Het
Hmbox1 A G 14: 64,828,579 probably benign Het
Hps3 C A 3: 20,012,783 V540F possibly damaging Het
Hsd3b6 T A 3: 98,806,237 I249F possibly damaging Het
Hunk T A 16: 90,432,500 probably null Het
Kidins220 T A 12: 25,057,423 L1625Q probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Myo10 T A 15: 25,722,259 L186Q probably benign Het
N4bp2 T A 5: 65,790,881 W285R probably damaging Het
Nat8l T C 5: 33,998,372 L124P probably damaging Het
Nemp2 T C 1: 52,641,066 probably null Het
Nkain2 G A 10: 32,329,817 T74I possibly damaging Het
Nol4 A G 18: 22,823,409 S239P probably damaging Het
Olfr1223 T A 2: 89,144,957 E22V probably benign Het
Pcbp3 T C 10: 76,789,755 I152V possibly damaging Het
Pcp4l1 G T 1: 171,175,605 P10Q probably damaging Het
Pla1a T C 16: 38,415,368 N135D probably damaging Het
Plb1 T A 5: 32,349,660 M1193K probably damaging Het
Prc1 T C 7: 80,312,284 V73A probably benign Het
Prkd2 T A 7: 16,869,565 W807R probably damaging Het
Ptprb C T 10: 116,315,038 probably benign Het
Rb1cc1 A G 1: 6,249,335 I993V probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnpep G T 1: 135,271,617 N334K probably damaging Het
Sarm1 G A 11: 78,475,289 P695S probably damaging Het
Sf3a3 C T 4: 124,718,343 T131I possibly damaging Het
Slc38a10 A T 11: 120,132,741 V283E probably damaging Het
Slco6c1 A T 1: 97,072,870 L552* probably null Het
Tas2r136 T C 6: 132,777,532 M211V probably benign Het
Tax1bp3 G A 11: 73,181,121 D65N probably damaging Het
Tdrd5 A G 1: 156,301,639 F167S probably damaging Het
Tfeb G A 17: 47,789,665 V269M probably damaging Het
Tspan12 A T 6: 21,799,888 F153L probably benign Het
Txnrd1 T G 10: 82,881,739 L186V probably damaging Het
Upk1b A T 16: 38,780,137 C160* probably null Het
Uty T C Y: 1,176,541 Q172R probably damaging Het
Vmn1r23 T C 6: 57,926,452 K114E possibly damaging Het
Vmn2r99 T G 17: 19,377,991 N92K probably damaging Het
Vstm2a T A 11: 16,263,191 M192K probably benign Het
Zc3h12c A G 9: 52,116,421 V547A probably benign Het
Zfp944 T A 17: 22,339,828 N146I probably benign Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1398:Rev3l UTSW 10 39821583 missense probably benign 0.05
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4724:Rev3l UTSW 10 39846806 nonsense probably null
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39823985 missense probably benign 0.30
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5628:Rev3l UTSW 10 39822967 missense probably damaging 0.98
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6812:Rev3l UTSW 10 39823548 missense probably benign
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
R7575:Rev3l UTSW 10 39821445 missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39821538 missense probably damaging 1.00
R7597:Rev3l UTSW 10 39822884 missense probably damaging 1.00
R7670:Rev3l UTSW 10 39836722 missense probably benign 0.01
R7804:Rev3l UTSW 10 39823485 missense probably benign 0.34
R7818:Rev3l UTSW 10 39823902 missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R7957:Rev3l UTSW 10 39822495 missense possibly damaging 0.72
R8059:Rev3l UTSW 10 39843495 missense probably damaging 1.00
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GTAATGGCCAAGCAGTTGTC -3'
(R):5'- CAGGGGAGCTGTAACTAACATAAC -3'

Sequencing Primer
(F):5'- CCAAGCAGTTGTCAATAAAGAGTC -3'
(R):5'- CTGACTGCATCCTGTAGT -3'
Posted On2014-09-18