Incidental Mutation 'R2101:Dscam'
ID230533
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene NameDS cell adhesion molecule
Synonyms4932410A21Rik
MMRRC Submission 040105-MU
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2101 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location96592079-97170752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96610349 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1776 (T1776A)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: T1776A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: T1776A

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (67/67)
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G A 2: 103,566,862 A46T probably benign Het
Agap3 T A 5: 24,487,799 L47Q probably damaging Het
Apaf1 T G 10: 91,060,080 I377L probably benign Het
Astn2 G A 4: 65,581,686 R937* probably null Het
Cacnb1 A C 11: 98,005,728 V369G probably damaging Het
Cdc42bpa G T 1: 180,146,968 V1464L probably benign Het
Cdkn2aip A T 8: 47,713,001 M90K probably damaging Het
Chd3 A T 11: 69,349,051 D1650E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca2 T C 3: 145,077,938 T639A probably damaging Het
Cluh G T 11: 74,660,502 probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Col11a2 A T 17: 34,052,169 D528V probably damaging Het
Cyfip2 A G 11: 46,242,443 L810P probably damaging Het
D430041D05Rik A G 2: 104,148,830 V2084A probably damaging Het
Dcc G A 18: 71,810,870 H237Y possibly damaging Het
Ddx60 T A 8: 61,940,645 F38L probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dock5 G T 14: 67,794,010 F990L probably benign Het
Dpy19l1 A T 9: 24,482,035 V146E probably damaging Het
Enpep C T 3: 129,298,938 S532N probably benign Het
Gdf6 A G 4: 9,860,025 D369G probably damaging Het
Gm6169 G T 13: 97,099,222 R6S probably damaging Het
Gtf2b T C 3: 142,771,383 probably benign Het
Hmbox1 A G 14: 64,828,579 probably benign Het
Hps3 C A 3: 20,012,783 V540F possibly damaging Het
Hsd3b6 T A 3: 98,806,237 I249F possibly damaging Het
Hunk T A 16: 90,432,500 probably null Het
Kidins220 T A 12: 25,057,423 L1625Q probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Myo10 T A 15: 25,722,259 L186Q probably benign Het
N4bp2 T A 5: 65,790,881 W285R probably damaging Het
Nat8l T C 5: 33,998,372 L124P probably damaging Het
Nemp2 T C 1: 52,641,066 probably null Het
Nkain2 G A 10: 32,329,817 T74I possibly damaging Het
Nol4 A G 18: 22,823,409 S239P probably damaging Het
Olfr1223 T A 2: 89,144,957 E22V probably benign Het
Pcbp3 T C 10: 76,789,755 I152V possibly damaging Het
Pcp4l1 G T 1: 171,175,605 P10Q probably damaging Het
Pla1a T C 16: 38,415,368 N135D probably damaging Het
Plb1 T A 5: 32,349,660 M1193K probably damaging Het
Prc1 T C 7: 80,312,284 V73A probably benign Het
Prkd2 T A 7: 16,869,565 W807R probably damaging Het
Ptprb C T 10: 116,315,038 probably benign Het
Rb1cc1 A G 1: 6,249,335 I993V probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rev3l T C 10: 39,828,096 V2046A probably benign Het
Rnpep G T 1: 135,271,617 N334K probably damaging Het
Sarm1 G A 11: 78,475,289 P695S probably damaging Het
Sf3a3 C T 4: 124,718,343 T131I possibly damaging Het
Slc38a10 A T 11: 120,132,741 V283E probably damaging Het
Slco6c1 A T 1: 97,072,870 L552* probably null Het
Tas2r136 T C 6: 132,777,532 M211V probably benign Het
Tax1bp3 G A 11: 73,181,121 D65N probably damaging Het
Tdrd5 A G 1: 156,301,639 F167S probably damaging Het
Tfeb G A 17: 47,789,665 V269M probably damaging Het
Tspan12 A T 6: 21,799,888 F153L probably benign Het
Txnrd1 T G 10: 82,881,739 L186V probably damaging Het
Upk1b A T 16: 38,780,137 C160* probably null Het
Uty T C Y: 1,176,541 Q172R probably damaging Het
Vmn1r23 T C 6: 57,926,452 K114E possibly damaging Het
Vmn2r99 T G 17: 19,377,991 N92K probably damaging Het
Vstm2a T A 11: 16,263,191 M192K probably benign Het
Zc3h12c A G 9: 52,116,421 V547A probably benign Het
Zfp944 T A 17: 22,339,828 N146I probably benign Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R1933:Dscam UTSW 16 96593214 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 intron probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 intron probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
R7843:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7911:Dscam UTSW 16 96643922 missense probably benign 0.01
R7926:Dscam UTSW 16 96825630 missense probably damaging 0.99
R7961:Dscam UTSW 16 96709421 intron probably null
R7992:Dscam UTSW 16 96643922 missense probably benign 0.01
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Z1177:Dscam UTSW 16 96608189 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACTCTCAGAGAAACGGTTGTC -3'
(R):5'- AGGGAGATGACAGCTGCTTG -3'

Sequencing Primer
(F):5'- CTCTCAGAGAAACGGTTGTCATTTG -3'
(R):5'- TCTGCTTGACCCCTGAAGACAG -3'
Posted On2014-09-18