Incidental Mutation 'R2101:Dscam'
ID 230533
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik, Down syndrome cell adhesion molecule
MMRRC Submission 040105-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2101 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 96392040-96971952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96411549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1776 (T1776A)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: T1776A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: T1776A

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G A 2: 103,397,207 (GRCm39) A46T probably benign Het
Agap3 T A 5: 24,692,797 (GRCm39) L47Q probably damaging Het
Apaf1 T G 10: 90,895,942 (GRCm39) I377L probably benign Het
Astn2 G A 4: 65,499,923 (GRCm39) R937* probably null Het
Cacnb1 A C 11: 97,896,554 (GRCm39) V369G probably damaging Het
Cdc42bpa G T 1: 179,974,533 (GRCm39) V1464L probably benign Het
Cdkn2aip A T 8: 48,166,036 (GRCm39) M90K probably damaging Het
Chd3 A T 11: 69,239,877 (GRCm39) D1650E probably benign Het
Chd9 C T 8: 91,760,615 (GRCm39) P2120L probably benign Het
Clca3a2 T C 3: 144,783,699 (GRCm39) T639A probably damaging Het
Cluh G T 11: 74,551,328 (GRCm39) probably benign Het
Cnga1 C T 5: 72,776,404 (GRCm39) V20I possibly damaging Het
Col11a2 A T 17: 34,271,143 (GRCm39) D528V probably damaging Het
Cyfip2 A G 11: 46,133,270 (GRCm39) L810P probably damaging Het
D430041D05Rik A G 2: 103,979,175 (GRCm39) V2084A probably damaging Het
Dcc G A 18: 71,943,941 (GRCm39) H237Y possibly damaging Het
Ddx60 T A 8: 62,393,679 (GRCm39) F38L probably damaging Het
Dio2 T C 12: 90,696,597 (GRCm39) *130W probably null Het
Dock5 G T 14: 68,031,459 (GRCm39) F990L probably benign Het
Dpy19l1 A T 9: 24,393,331 (GRCm39) V146E probably damaging Het
Enpep C T 3: 129,092,587 (GRCm39) S532N probably benign Het
Gdf6 A G 4: 9,860,025 (GRCm39) D369G probably damaging Het
Gtf2b T C 3: 142,477,144 (GRCm39) probably benign Het
Hmbox1 A G 14: 65,066,028 (GRCm39) probably benign Het
Hps3 C A 3: 20,066,947 (GRCm39) V540F possibly damaging Het
Hsd3b6 T A 3: 98,713,553 (GRCm39) I249F possibly damaging Het
Hunk T A 16: 90,229,388 (GRCm39) probably null Het
Kidins220 T A 12: 25,107,422 (GRCm39) L1625Q probably damaging Het
Krt1 C T 15: 101,754,622 (GRCm39) G543S unknown Het
Myo10 T A 15: 25,722,345 (GRCm39) L186Q probably benign Het
N4bp2 T A 5: 65,948,224 (GRCm39) W285R probably damaging Het
Nat8l T C 5: 34,155,716 (GRCm39) L124P probably damaging Het
Nemp2 T C 1: 52,680,225 (GRCm39) probably null Het
Nkain2 G A 10: 32,205,813 (GRCm39) T74I possibly damaging Het
Nol4 A G 18: 22,956,466 (GRCm39) S239P probably damaging Het
Or4c118 T A 2: 88,975,301 (GRCm39) E22V probably benign Het
Pcbp3 T C 10: 76,625,589 (GRCm39) I152V possibly damaging Het
Pcp4l1 G T 1: 171,003,174 (GRCm39) P10Q probably damaging Het
Pla1a T C 16: 38,235,730 (GRCm39) N135D probably damaging Het
Plb1 T A 5: 32,507,004 (GRCm39) M1193K probably damaging Het
Prc1 T C 7: 79,962,032 (GRCm39) V73A probably benign Het
Prkd2 T A 7: 16,603,490 (GRCm39) W807R probably damaging Het
Prp2rt G T 13: 97,235,730 (GRCm39) R6S probably damaging Het
Ptprb C T 10: 116,150,943 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,319,559 (GRCm39) I993V probably benign Het
Rbp3 C T 14: 33,677,975 (GRCm39) T641M probably damaging Het
Rev3l T C 10: 39,704,092 (GRCm39) V2046A probably benign Het
Rnpep G T 1: 135,199,355 (GRCm39) N334K probably damaging Het
Sarm1 G A 11: 78,366,115 (GRCm39) P695S probably damaging Het
Sf3a3 C T 4: 124,612,136 (GRCm39) T131I possibly damaging Het
Slc38a10 A T 11: 120,023,567 (GRCm39) V283E probably damaging Het
Slco6c1 A T 1: 97,000,595 (GRCm39) L552* probably null Het
Tas2r136 T C 6: 132,754,495 (GRCm39) M211V probably benign Het
Tax1bp3 G A 11: 73,071,947 (GRCm39) D65N probably damaging Het
Tdrd5 A G 1: 156,129,209 (GRCm39) F167S probably damaging Het
Tfeb G A 17: 48,100,590 (GRCm39) V269M probably damaging Het
Tspan12 A T 6: 21,799,887 (GRCm39) F153L probably benign Het
Txnrd1 T G 10: 82,717,573 (GRCm39) L186V probably damaging Het
Upk1b A T 16: 38,600,499 (GRCm39) C160* probably null Het
Uty T C Y: 1,176,541 (GRCm39) Q172R probably damaging Het
Vmn1r23 T C 6: 57,903,437 (GRCm39) K114E possibly damaging Het
Vmn2r99 T G 17: 19,598,253 (GRCm39) N92K probably damaging Het
Vstm2a T A 11: 16,213,191 (GRCm39) M192K probably benign Het
Zc3h12c A G 9: 52,027,721 (GRCm39) V547A probably benign Het
Zfp944 T A 17: 22,558,809 (GRCm39) N146I probably benign Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96,409,265 (GRCm39) missense possibly damaging 0.64
IGL00841:Dscam APN 16 96,621,077 (GRCm39) missense probably damaging 1.00
IGL01289:Dscam APN 16 96,445,082 (GRCm39) nonsense probably null
IGL01358:Dscam APN 16 96,411,543 (GRCm39) missense possibly damaging 0.68
IGL01431:Dscam APN 16 96,453,278 (GRCm39) critical splice donor site probably null
IGL01444:Dscam APN 16 96,474,909 (GRCm39) missense possibly damaging 0.95
IGL01767:Dscam APN 16 96,456,136 (GRCm39) missense probably damaging 1.00
IGL01866:Dscam APN 16 96,486,550 (GRCm39) missense probably benign 0.06
IGL02020:Dscam APN 16 96,517,269 (GRCm39) missense probably damaging 1.00
IGL02023:Dscam APN 16 96,602,397 (GRCm39) missense probably benign 0.06
IGL02057:Dscam APN 16 96,517,273 (GRCm39) nonsense probably null
IGL02389:Dscam APN 16 96,442,097 (GRCm39) missense probably benign 0.27
IGL02409:Dscam APN 16 96,621,088 (GRCm39) missense possibly damaging 0.46
IGL02694:Dscam APN 16 96,394,476 (GRCm39) missense probably benign 0.00
IGL02899:Dscam APN 16 96,510,447 (GRCm39) missense probably damaging 0.98
IGL02956:Dscam APN 16 96,602,472 (GRCm39) missense probably damaging 0.98
IGL03035:Dscam APN 16 96,621,170 (GRCm39) missense possibly damaging 0.94
IGL03191:Dscam APN 16 96,621,969 (GRCm39) missense probably benign 0.36
growler UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
Twostep UTSW 16 96,626,982 (GRCm39) splice site probably null
F6893:Dscam UTSW 16 96,857,660 (GRCm39) missense possibly damaging 0.78
K3955:Dscam UTSW 16 96,474,887 (GRCm39) missense probably benign 0.00
R0024:Dscam UTSW 16 96,394,585 (GRCm39) nonsense probably null
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0117:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R0211:Dscam UTSW 16 96,517,279 (GRCm39) missense possibly damaging 0.50
R0280:Dscam UTSW 16 96,840,206 (GRCm39) missense possibly damaging 0.62
R0355:Dscam UTSW 16 96,456,105 (GRCm39) missense probably benign 0.00
R0380:Dscam UTSW 16 96,857,810 (GRCm39) missense probably damaging 1.00
R0445:Dscam UTSW 16 96,573,703 (GRCm39) missense probably damaging 1.00
R0492:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0534:Dscam UTSW 16 96,453,372 (GRCm39) missense possibly damaging 0.67
R0593:Dscam UTSW 16 96,573,608 (GRCm39) missense probably benign 0.19
R0707:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0738:Dscam UTSW 16 96,620,981 (GRCm39) missense possibly damaging 0.48
R1017:Dscam UTSW 16 96,634,633 (GRCm39) missense probably damaging 1.00
R1377:Dscam UTSW 16 96,573,694 (GRCm39) missense probably damaging 1.00
R1440:Dscam UTSW 16 96,621,151 (GRCm39) missense probably damaging 1.00
R1442:Dscam UTSW 16 96,409,274 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1478:Dscam UTSW 16 96,592,110 (GRCm39) missense probably benign 0.15
R1530:Dscam UTSW 16 96,621,074 (GRCm39) missense probably damaging 1.00
R1731:Dscam UTSW 16 96,621,076 (GRCm39) missense probably damaging 1.00
R1765:Dscam UTSW 16 96,486,579 (GRCm39) missense probably benign 0.00
R1824:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign 0.00
R1933:Dscam UTSW 16 96,394,414 (GRCm39) missense probably benign 0.00
R2005:Dscam UTSW 16 96,840,120 (GRCm39) missense probably benign 0.02
R2006:Dscam UTSW 16 96,621,112 (GRCm39) missense probably damaging 1.00
R2177:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 0.98
R2342:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R2851:Dscam UTSW 16 96,423,915 (GRCm39) missense possibly damaging 0.94
R2929:Dscam UTSW 16 96,486,612 (GRCm39) missense possibly damaging 0.76
R3055:Dscam UTSW 16 96,602,555 (GRCm39) missense probably damaging 1.00
R3157:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3159:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3944:Dscam UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
R4080:Dscam UTSW 16 96,484,972 (GRCm39) missense probably benign 0.01
R4285:Dscam UTSW 16 96,510,309 (GRCm39) critical splice donor site probably null
R4384:Dscam UTSW 16 96,510,416 (GRCm39) missense probably damaging 0.99
R4460:Dscam UTSW 16 96,411,519 (GRCm39) missense probably damaging 1.00
R4575:Dscam UTSW 16 96,626,823 (GRCm39) missense possibly damaging 0.82
R4594:Dscam UTSW 16 96,519,196 (GRCm39) missense possibly damaging 0.78
R4643:Dscam UTSW 16 96,486,501 (GRCm39) missense probably damaging 0.96
R4698:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R4716:Dscam UTSW 16 96,420,771 (GRCm39) missense possibly damaging 0.80
R4743:Dscam UTSW 16 96,631,256 (GRCm39) missense probably benign 0.00
R4766:Dscam UTSW 16 96,445,188 (GRCm39) missense probably benign 0.02
R4899:Dscam UTSW 16 96,485,018 (GRCm39) missense probably benign 0.01
R4987:Dscam UTSW 16 96,498,721 (GRCm39) missense probably benign 0.00
R4990:Dscam UTSW 16 96,626,715 (GRCm39) missense probably benign 0.12
R5123:Dscam UTSW 16 96,573,637 (GRCm39) missense probably damaging 1.00
R5130:Dscam UTSW 16 96,620,979 (GRCm39) missense probably benign 0.00
R5328:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R5666:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5670:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5678:Dscam UTSW 16 96,592,100 (GRCm39) missense probably benign 0.16
R5827:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R5907:Dscam UTSW 16 96,622,120 (GRCm39) missense probably damaging 0.97
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6103:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign
R6240:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R6257:Dscam UTSW 16 96,474,914 (GRCm39) missense possibly damaging 0.94
R6361:Dscam UTSW 16 96,424,011 (GRCm39) missense probably benign 0.08
R6405:Dscam UTSW 16 96,479,625 (GRCm39) missense probably damaging 1.00
R6444:Dscam UTSW 16 96,420,844 (GRCm39) missense probably damaging 1.00
R6560:Dscam UTSW 16 96,626,935 (GRCm39) missense probably benign 0.00
R6598:Dscam UTSW 16 96,620,984 (GRCm39) missense probably damaging 1.00
R6622:Dscam UTSW 16 96,446,273 (GRCm39) missense probably benign 0.06
R6792:Dscam UTSW 16 96,449,437 (GRCm39) missense probably damaging 1.00
R6792:Dscam UTSW 16 96,394,455 (GRCm39) missense probably damaging 0.96
R6827:Dscam UTSW 16 96,840,191 (GRCm39) missense probably damaging 1.00
R6868:Dscam UTSW 16 96,631,140 (GRCm39) missense probably damaging 1.00
R6898:Dscam UTSW 16 96,631,100 (GRCm39) missense probably benign 0.02
R6903:Dscam UTSW 16 96,621,988 (GRCm39) missense probably damaging 1.00
R7051:Dscam UTSW 16 96,620,986 (GRCm39) missense probably benign 0.01
R7146:Dscam UTSW 16 96,631,117 (GRCm39) nonsense probably null
R7180:Dscam UTSW 16 96,626,764 (GRCm39) missense probably damaging 0.97
R7209:Dscam UTSW 16 96,451,544 (GRCm39) splice site probably null
R7247:Dscam UTSW 16 96,622,008 (GRCm39) missense probably damaging 0.99
R7269:Dscam UTSW 16 96,479,601 (GRCm39) missense probably benign 0.00
R7301:Dscam UTSW 16 96,857,732 (GRCm39) missense probably benign 0.01
R7328:Dscam UTSW 16 96,446,235 (GRCm39) nonsense probably null
R7368:Dscam UTSW 16 96,445,131 (GRCm39) missense probably benign 0.00
R7425:Dscam UTSW 16 96,430,598 (GRCm39) missense probably damaging 1.00
R7474:Dscam UTSW 16 96,621,089 (GRCm39) missense possibly damaging 0.88
R7536:Dscam UTSW 16 96,442,226 (GRCm39) splice site probably null
R7624:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R7766:Dscam UTSW 16 96,592,101 (GRCm39) missense probably benign 0.31
R7817:Dscam UTSW 16 96,442,064 (GRCm39) missense probably benign
R7843:Dscam UTSW 16 96,626,830 (GRCm39) missense probably damaging 0.99
R7911:Dscam UTSW 16 96,445,122 (GRCm39) missense probably benign 0.01
R8108:Dscam UTSW 16 96,445,079 (GRCm39) missense probably benign 0.01
R8128:Dscam UTSW 16 96,602,374 (GRCm39) splice site probably null
R8770:Dscam UTSW 16 96,456,106 (GRCm39) missense possibly damaging 0.50
R8876:Dscam UTSW 16 96,420,828 (GRCm39) missense probably damaging 0.96
R9005:Dscam UTSW 16 96,602,580 (GRCm39) missense probably damaging 1.00
R9009:Dscam UTSW 16 96,840,116 (GRCm39) missense probably benign 0.10
R9168:Dscam UTSW 16 96,420,768 (GRCm39) missense possibly damaging 0.82
R9176:Dscam UTSW 16 96,486,553 (GRCm39) missense probably benign 0.37
R9244:Dscam UTSW 16 96,486,429 (GRCm39) missense possibly damaging 0.62
R9339:Dscam UTSW 16 96,517,263 (GRCm39) missense possibly damaging 0.89
R9374:Dscam UTSW 16 96,857,857 (GRCm39) missense probably benign 0.19
R9385:Dscam UTSW 16 96,840,203 (GRCm39) missense probably benign
R9674:Dscam UTSW 16 96,442,036 (GRCm39) missense probably benign 0.03
X0025:Dscam UTSW 16 96,510,361 (GRCm39) missense probably damaging 1.00
Z1088:Dscam UTSW 16 96,573,761 (GRCm39) missense probably benign 0.01
Z1177:Dscam UTSW 16 96,409,389 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACTCTCAGAGAAACGGTTGTC -3'
(R):5'- AGGGAGATGACAGCTGCTTG -3'

Sequencing Primer
(F):5'- CTCTCAGAGAAACGGTTGTCATTTG -3'
(R):5'- TCTGCTTGACCCCTGAAGACAG -3'
Posted On 2014-09-18