Incidental Mutation 'R2101:Vmn2r99'
ID230534
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Namevomeronasal 2, receptor 99
SynonymsEG665376
MMRRC Submission 040105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2101 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19361949-19401098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19377991 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 92 (N92K)
Ref Sequence ENSEMBL: ENSMUSP00000156067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
Predicted Effect probably damaging
Transcript: ENSMUST00000176107
AA Change: N92K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: N92K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231989
AA Change: N92K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G A 2: 103,566,862 A46T probably benign Het
Agap3 T A 5: 24,487,799 L47Q probably damaging Het
Apaf1 T G 10: 91,060,080 I377L probably benign Het
Astn2 G A 4: 65,581,686 R937* probably null Het
Cacnb1 A C 11: 98,005,728 V369G probably damaging Het
Cdc42bpa G T 1: 180,146,968 V1464L probably benign Het
Cdkn2aip A T 8: 47,713,001 M90K probably damaging Het
Chd3 A T 11: 69,349,051 D1650E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca2 T C 3: 145,077,938 T639A probably damaging Het
Cluh G T 11: 74,660,502 probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Col11a2 A T 17: 34,052,169 D528V probably damaging Het
Cyfip2 A G 11: 46,242,443 L810P probably damaging Het
D430041D05Rik A G 2: 104,148,830 V2084A probably damaging Het
Dcc G A 18: 71,810,870 H237Y possibly damaging Het
Ddx60 T A 8: 61,940,645 F38L probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dock5 G T 14: 67,794,010 F990L probably benign Het
Dpy19l1 A T 9: 24,482,035 V146E probably damaging Het
Dscam T C 16: 96,610,349 T1776A probably benign Het
Enpep C T 3: 129,298,938 S532N probably benign Het
Gdf6 A G 4: 9,860,025 D369G probably damaging Het
Gm6169 G T 13: 97,099,222 R6S probably damaging Het
Gtf2b T C 3: 142,771,383 probably benign Het
Hmbox1 A G 14: 64,828,579 probably benign Het
Hps3 C A 3: 20,012,783 V540F possibly damaging Het
Hsd3b6 T A 3: 98,806,237 I249F possibly damaging Het
Hunk T A 16: 90,432,500 probably null Het
Kidins220 T A 12: 25,057,423 L1625Q probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Myo10 T A 15: 25,722,259 L186Q probably benign Het
N4bp2 T A 5: 65,790,881 W285R probably damaging Het
Nat8l T C 5: 33,998,372 L124P probably damaging Het
Nemp2 T C 1: 52,641,066 probably null Het
Nkain2 G A 10: 32,329,817 T74I possibly damaging Het
Nol4 A G 18: 22,823,409 S239P probably damaging Het
Olfr1223 T A 2: 89,144,957 E22V probably benign Het
Pcbp3 T C 10: 76,789,755 I152V possibly damaging Het
Pcp4l1 G T 1: 171,175,605 P10Q probably damaging Het
Pla1a T C 16: 38,415,368 N135D probably damaging Het
Plb1 T A 5: 32,349,660 M1193K probably damaging Het
Prc1 T C 7: 80,312,284 V73A probably benign Het
Prkd2 T A 7: 16,869,565 W807R probably damaging Het
Ptprb C T 10: 116,315,038 probably benign Het
Rb1cc1 A G 1: 6,249,335 I993V probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rev3l T C 10: 39,828,096 V2046A probably benign Het
Rnpep G T 1: 135,271,617 N334K probably damaging Het
Sarm1 G A 11: 78,475,289 P695S probably damaging Het
Sf3a3 C T 4: 124,718,343 T131I possibly damaging Het
Slc38a10 A T 11: 120,132,741 V283E probably damaging Het
Slco6c1 A T 1: 97,072,870 L552* probably null Het
Tas2r136 T C 6: 132,777,532 M211V probably benign Het
Tax1bp3 G A 11: 73,181,121 D65N probably damaging Het
Tdrd5 A G 1: 156,301,639 F167S probably damaging Het
Tfeb G A 17: 47,789,665 V269M probably damaging Het
Tspan12 A T 6: 21,799,888 F153L probably benign Het
Txnrd1 T G 10: 82,881,739 L186V probably damaging Het
Upk1b A T 16: 38,780,137 C160* probably null Het
Uty T C Y: 1,176,541 Q172R probably damaging Het
Vmn1r23 T C 6: 57,926,452 K114E possibly damaging Het
Vstm2a T A 11: 16,263,191 M192K probably benign Het
Zc3h12c A G 9: 52,116,421 V547A probably benign Het
Zfp944 T A 17: 22,339,828 N146I probably benign Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CTAGTTCAACTGTTCATGGTGAAG -3'
(R):5'- CCCAGTTAGAGCAGATGTTATCC -3'

Sequencing Primer
(F):5'- CTCTACTAAATATGTAGATGTGTATG -3'
(R):5'- TCCAAGAAGTTCCTGTCAGTGCAG -3'
Posted On2014-09-18