Incidental Mutation 'R0179:Tsen54'
ID23059
Institutional Source Beutler Lab
Gene Symbol Tsen54
Ensembl Gene ENSMUSG00000020781
Gene NametRNA splicing endonuclease subunit 54
Synonyms
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0179 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115814724-115823094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115822030 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 131 (S131C)
Ref Sequence ENSEMBL: ENSMUSP00000116955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021134] [ENSMUST00000103032] [ENSMUST00000106481] [ENSMUST00000133250] [ENSMUST00000136343] [ENSMUST00000154304] [ENSMUST00000177736]
Predicted Effect probably damaging
Transcript: ENSMUST00000021134
AA Change: S448C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021134
Gene: ENSMUSG00000020781
AA Change: S448C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 63 130 1.4e-21 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106481
SMART Domains Protein: ENSMUSP00000102090
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 62 132 1.9e-23 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128266
Predicted Effect probably benign
Transcript: ENSMUST00000133250
SMART Domains Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 146 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136343
SMART Domains Protein: ENSMUSP00000120506
Gene: ENSMUSG00000020781

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 158 168 N/A INTRINSIC
coiled coil region 182 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141748
Predicted Effect probably damaging
Transcript: ENSMUST00000154304
AA Change: S131C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116955
Gene: ENSMUSG00000020781
AA Change: S131C

DomainStartEndE-ValueType
coiled coil region 21 43 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000157061
AA Change: S85C
Predicted Effect probably benign
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Tsen54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Tsen54 APN 11 115821712 missense possibly damaging 0.90
PIT4486001:Tsen54 UTSW 11 115822596 missense probably damaging 1.00
R0255:Tsen54 UTSW 11 115815408 missense probably damaging 1.00
R0380:Tsen54 UTSW 11 115822597 missense probably damaging 1.00
R0619:Tsen54 UTSW 11 115815064 missense probably damaging 1.00
R0653:Tsen54 UTSW 11 115815061 missense probably damaging 1.00
R1120:Tsen54 UTSW 11 115815013 missense probably damaging 0.98
R2109:Tsen54 UTSW 11 115815723 missense probably damaging 1.00
R2248:Tsen54 UTSW 11 115815406 missense probably damaging 1.00
R2300:Tsen54 UTSW 11 115822078 missense probably damaging 1.00
R3081:Tsen54 UTSW 11 115820164 missense probably benign 0.08
R3763:Tsen54 UTSW 11 115820411 missense probably benign 0.22
R4179:Tsen54 UTSW 11 115820852 missense probably damaging 0.99
R4521:Tsen54 UTSW 11 115817106 critical splice donor site probably null
R4618:Tsen54 UTSW 11 115815421 unclassified probably benign
R5485:Tsen54 UTSW 11 115815222 missense probably benign 0.15
R6111:Tsen54 UTSW 11 115820130 missense possibly damaging 0.82
R6238:Tsen54 UTSW 11 115820687 missense probably benign 0.02
R6459:Tsen54 UTSW 11 115821680 missense probably damaging 1.00
R6555:Tsen54 UTSW 11 115820693 missense probably benign 0.43
R7378:Tsen54 UTSW 11 115821705 missense probably benign 0.19
R7520:Tsen54 UTSW 11 115820971 missense probably damaging 0.99
X0028:Tsen54 UTSW 11 115817099 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGAAGGCTGACTCCCTTCCTCAAC -3'
(R):5'- TTCAGGGTCTGGCAAACTGGTG -3'

Sequencing Primer
(F):5'- GGGACACCTGCCTATATACTTAG -3'
(R):5'- ACTGGTGGCAGGGTTCAAG -3'
Posted On2013-04-16