Incidental Mutation 'R2102:Rgl2'
ID 230628
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 040106-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R2102 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 34152314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 137,770,934 (GRCm39) L41P probably damaging Het
Abca8a G T 11: 109,958,878 (GRCm39) P749T probably damaging Het
Acad8 A T 9: 26,896,861 (GRCm39) Y199* probably null Het
Acot12 A T 13: 91,908,096 (GRCm39) I93L probably benign Het
Acsbg3 T A 17: 57,191,949 (GRCm39) Y542* probably null Het
Actn1 C A 12: 80,230,291 (GRCm39) R321L probably benign Het
Ap3s1 A G 18: 46,887,469 (GRCm39) E34G possibly damaging Het
Armh4 A G 14: 50,011,459 (GRCm39) Y83H probably damaging Het
Atp5f1a T C 18: 77,870,017 (GRCm39) S533P probably damaging Het
Bcorl1 T C X: 47,458,081 (GRCm39) V538A probably benign Het
Cdhr4 A G 9: 107,875,206 (GRCm39) T689A probably damaging Het
Cdk19 A T 10: 40,355,726 (GRCm39) probably benign Het
Cobll1 G T 2: 64,928,554 (GRCm39) P923Q probably damaging Het
Cpt1a T C 19: 3,421,585 (GRCm39) S456P probably benign Het
Cst11 T C 2: 148,613,160 (GRCm39) Y55C probably damaging Het
Ctif T G 18: 75,654,452 (GRCm39) D358A probably benign Het
Cyp2d34 T G 15: 82,500,974 (GRCm39) E386A probably benign Het
Dcxr A G 11: 120,617,133 (GRCm39) F104L probably benign Het
Dmbt1 G T 7: 130,703,762 (GRCm39) W1107C probably damaging Het
Dsg1a A T 18: 20,466,830 (GRCm39) I567F probably damaging Het
Ednrb T A 14: 104,058,350 (GRCm39) R318* probably null Het
Exd2 T C 12: 80,527,377 (GRCm39) I36T possibly damaging Het
Fam83b A T 9: 76,399,987 (GRCm39) I372N probably damaging Het
Fbh1 A G 2: 11,763,100 (GRCm39) V518A probably benign Het
Fkbp5 T C 17: 28,625,162 (GRCm39) E308G possibly damaging Het
Foxl2 A C 9: 98,838,282 (GRCm39) Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,043,585 (GRCm39) probably benign Het
Galnt17 C T 5: 131,114,831 (GRCm39) R223Q probably damaging Het
Gm14496 G A 2: 181,633,127 (GRCm39) D37N possibly damaging Het
Gpr82 T C X: 13,532,274 (GRCm39) V274A probably benign Het
Hsp90aa1 T C 12: 110,660,566 (GRCm39) N292S probably damaging Het
Ints1 C T 5: 139,741,754 (GRCm39) V1826M possibly damaging Het
Itgb4 A G 11: 115,896,561 (GRCm39) D1440G probably benign Het
Kdm3b A G 18: 34,963,200 (GRCm39) D1552G probably damaging Het
Kel G A 6: 41,663,418 (GRCm39) T702I possibly damaging Het
Klf3 T C 5: 64,979,266 (GRCm39) V36A probably damaging Het
Klhl23 A T 2: 69,659,228 (GRCm39) I418F probably damaging Het
Kndc1 A T 7: 139,510,674 (GRCm39) I1329L probably benign Het
Krtap2-4 T C 11: 99,505,606 (GRCm39) probably benign Het
Krtap9-5 T A 11: 99,840,270 (GRCm39) C324S unknown Het
Lepr T C 4: 101,630,178 (GRCm39) V631A possibly damaging Het
Lifr T C 15: 7,216,404 (GRCm39) I793T probably damaging Het
Mcoln1 G A 8: 3,561,731 (GRCm39) R427H probably damaging Het
Mgat5b G A 11: 116,810,255 (GRCm39) probably benign Het
Mmp12 G A 9: 7,349,802 (GRCm39) V78M probably damaging Het
Mrgprb8 T A 7: 48,038,634 (GRCm39) L102M possibly damaging Het
Mybphl A G 3: 108,282,949 (GRCm39) T246A possibly damaging Het
Myo7b A T 18: 32,133,031 (GRCm39) F439L probably damaging Het
Myom1 A T 17: 71,408,024 (GRCm39) D1088V probably damaging Het
Nrcam T C 12: 44,623,471 (GRCm39) F1004S probably benign Het
Palld A T 8: 61,986,467 (GRCm39) M788K possibly damaging Het
Pappa T A 4: 65,234,465 (GRCm39) Y1423* probably null Het
Pfkm A G 15: 98,027,171 (GRCm39) K615E probably damaging Het
Pkd1l2 G T 8: 117,808,208 (GRCm39) D105E probably damaging Het
Plekha5 G A 6: 140,518,603 (GRCm39) A297T probably damaging Het
Plxnb1 T A 9: 108,944,810 (GRCm39) M2051K probably damaging Het
Ppp6r2 A G 15: 89,162,949 (GRCm39) T524A probably damaging Het
Psg26 T C 7: 18,209,067 (GRCm39) E447G probably damaging Het
Rab3gap2 A G 1: 185,014,586 (GRCm39) D1225G probably benign Het
Rep15 A G 6: 146,934,403 (GRCm39) probably null Het
Rpl7a T G 2: 26,801,473 (GRCm39) V55G possibly damaging Het
Rtp1 A T 16: 23,250,108 (GRCm39) I158F probably benign Het
Scaper A T 9: 55,819,334 (GRCm39) V127E probably benign Het
Sele T A 1: 163,881,395 (GRCm39) C501S probably damaging Het
Serpina11 C T 12: 103,949,104 (GRCm39) V358I probably benign Het
Slc16a4 A G 3: 107,211,819 (GRCm39) probably null Het
Slco6c1 T C 1: 97,055,656 (GRCm39) I82V probably benign Het
Smarca5 T C 8: 81,431,304 (GRCm39) E971G probably damaging Het
Smr2 T C 5: 88,256,595 (GRCm39) L91P probably damaging Het
Spata31f3 T A 4: 42,868,558 (GRCm39) H355L probably benign Het
Spopfm2 A T 3: 94,082,973 (GRCm39) C279* probably null Het
Srrm2 A G 17: 24,036,722 (GRCm39) probably benign Het
Sting1 A T 18: 35,868,290 (GRCm39) M270K probably damaging Het
Syne1 A G 10: 5,006,514 (GRCm39) W7980R probably damaging Het
Syne2 A G 12: 76,074,853 (GRCm39) T4598A probably benign Het
Tmem171 A T 13: 98,828,851 (GRCm39) F100I probably damaging Het
Tnfrsf10b A G 14: 70,013,546 (GRCm39) T159A probably benign Het
Tph1 A T 7: 46,309,834 (GRCm39) probably null Het
Trim46 A T 3: 89,142,504 (GRCm39) I638N probably damaging Het
Ubl7 G A 9: 57,827,825 (GRCm39) D171N probably damaging Het
Utp20 A G 10: 88,608,779 (GRCm39) Y1514H probably damaging Het
Vmn2r81 A G 10: 79,129,334 (GRCm39) I742V probably damaging Het
Xrcc2 A T 5: 25,897,505 (GRCm39) V148E probably damaging Het
Zbed3 A G 13: 95,472,615 (GRCm39) D13G possibly damaging Het
Zdhhc25 T A 15: 88,484,962 (GRCm39) L99Q probably benign Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTCAACAAGGTGGCG -3'
(R):5'- AACAGGCCTCTGAGCACAAG -3'

Sequencing Primer
(F):5'- GGGGCCACCTCAATTGGAG -3'
(R):5'- TCTGAGCACAAGCCTGGC -3'
Posted On 2014-09-18