Mutagenetix > Incidental Mutations

Incidental Mutation 'R2102:Rgl2'

230628

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

MMRRC Submission

040106-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R2102 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 33933340 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025161

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047503

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172468

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173153

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173266

Predicted Effect

probably benign
Transcript: ENSMUST00000173284

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174442

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174676

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,065,173	L41P	probably damaging	Het
1700061G19Rik	T	A	17: 56,884,949	Y542*	probably null	Het
3632451O06Rik	A	G	14: 49,774,002	Y83H	probably damaging	Het
Abca8a	G	T	11: 110,068,052	P749T	probably damaging	Het
Acad8	A	T	9: 26,985,565	Y199*	probably null	Het
Acot12	A	T	13: 91,759,977	I93L	probably benign	Het
Actn1	C	A	12: 80,183,517	R321L	probably benign	Het
Ap3s1	A	G	18: 46,754,402	E34G	possibly damaging	Het
Atp5a1	T	C	18: 77,782,317	S533P	probably damaging	Het
Bcorl1	T	C	X: 48,369,204	V538A	probably benign	Het
Cdhr4	A	G	9: 107,998,007	T689A	probably damaging	Het
Cdk19	A	T	10: 40,479,730		probably benign	Het
Cobll1	G	T	2: 65,098,210	P923Q	probably damaging	Het
Cpt1a	T	C	19: 3,371,585	S456P	probably benign	Het
Cst11	T	C	2: 148,771,240	Y55C	probably damaging	Het
Ctif	T	G	18: 75,521,381	D358A	probably benign	Het
Cyp2d34	T	G	15: 82,616,773	E386A	probably benign	Het
Dcxr	A	G	11: 120,726,307	F104L	probably benign	Het
Dmbt1	G	T	7: 131,102,032	W1107C	probably damaging	Het
Dsg1a	A	T	18: 20,333,773	I567F	probably damaging	Het
Ednrb	T	A	14: 103,820,914	R318*	probably null	Het
Exd2	T	C	12: 80,480,603	I36T	possibly damaging	Het
Fam205c	T	A	4: 42,868,558	H355L	probably benign	Het
Fam83b	A	T	9: 76,492,705	I372N	probably damaging	Het
Fbxo18	A	G	2: 11,758,289	V518A	probably benign	Het
Fkbp5	T	C	17: 28,406,188	E308G	possibly damaging	Het
Foxl2	A	C	9: 98,956,229	Y190S	probably damaging	Het
Gab3	TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	X: 74,999,979		probably benign	Het
Galnt17	C	T	5: 131,085,993	R223Q	probably damaging	Het
Gm10696	A	T	3: 94,175,666	C279*	probably null	Het
Gm14496	G	A	2: 181,991,334	D37N	possibly damaging	Het
Gpr82	T	C	X: 13,666,035	V274A	probably benign	Het
Hsp90aa1	T	C	12: 110,694,132	N292S	probably damaging	Het
Ints1	C	T	5: 139,755,999	V1826M	possibly damaging	Het
Itgb4	A	G	11: 116,005,735	D1440G	probably benign	Het
Kdm3b	A	G	18: 34,830,147	D1552G	probably damaging	Het
Kel	G	A	6: 41,686,484	T702I	possibly damaging	Het
Klf3	T	C	5: 64,821,923	V36A	probably damaging	Het
Klhl23	A	T	2: 69,828,884	I418F	probably damaging	Het
Kndc1	A	T	7: 139,930,761	I1329L	probably benign	Het
Krtap2-4	T	C	11: 99,614,780		probably benign	Het
Krtap9-5	T	A	11: 99,949,444	C324S	unknown	Het
Lepr	T	C	4: 101,772,981	V631A	possibly damaging	Het
Lifr	T	C	15: 7,186,923	I793T	probably damaging	Het
Mcoln1	G	A	8: 3,511,731	R427H	probably damaging	Het
Mgat5b	G	A	11: 116,919,429		probably benign	Het
Mmp12	G	A	9: 7,349,802	V78M	probably damaging	Het
Mrgprb8	T	A	7: 48,388,886	L102M	possibly damaging	Het
Mybphl	A	G	3: 108,375,633	T246A	possibly damaging	Het
Myo7b	A	T	18: 31,999,978	F439L	probably damaging	Het
Myom1	A	T	17: 71,101,029	D1088V	probably damaging	Het
Nrcam	T	C	12: 44,576,688	F1004S	probably benign	Het
Palld	A	T	8: 61,533,433	M788K	possibly damaging	Het
Pappa	T	A	4: 65,316,228	Y1423*	probably null	Het
Pfkm	A	G	15: 98,129,290	K615E	probably damaging	Het
Pkd1l2	G	T	8: 117,081,469	D105E	probably damaging	Het
Plekha5	G	A	6: 140,572,877	A297T	probably damaging	Het
Plxnb1	T	A	9: 109,115,742	M2051K	probably damaging	Het
Ppp6r2	A	G	15: 89,278,746	T524A	probably damaging	Het
Psg26	T	C	7: 18,475,142	E447G	probably damaging	Het
Rab3gap2	A	G	1: 185,282,389	D1225G	probably benign	Het
Rep15	A	G	6: 147,032,905		probably null	Het
Rpl7a	T	G	2: 26,911,461	V55G	possibly damaging	Het
Rtp1	A	T	16: 23,431,358	I158F	probably benign	Het
Scaper	A	T	9: 55,912,050	V127E	probably benign	Het
Sele	T	A	1: 164,053,826	C501S	probably damaging	Het
Serpina11	C	T	12: 103,982,845	V358I	probably benign	Het
Slc16a4	A	G	3: 107,304,503		probably null	Het
Slco6c1	T	C	1: 97,127,931	I82V	probably benign	Het
Smarca5	T	C	8: 80,704,675	E971G	probably damaging	Het
Smr2	T	C	5: 88,108,736	L91P	probably damaging	Het
Srrm2	A	G	17: 23,817,748		probably benign	Het
Syne1	A	G	10: 5,056,514	W7980R	probably damaging	Het
Syne2	A	G	12: 76,028,079	T4598A	probably benign	Het
Tmem171	A	T	13: 98,692,343	F100I	probably damaging	Het
Tmem173	A	T	18: 35,735,237	M270K	probably damaging	Het
Tnfrsf10b	A	G	14: 69,776,097	T159A	probably benign	Het
Tph1	A	T	7: 46,660,410		probably null	Het
Trim46	A	T	3: 89,235,197	I638N	probably damaging	Het
Ubl7	G	A	9: 57,920,542	D171N	probably damaging	Het
Utp20	A	G	10: 88,772,917	Y1514H	probably damaging	Het
Vmn2r81	A	G	10: 79,293,500	I742V	probably damaging	Het
Xrcc2	A	T	5: 25,692,507	V148E	probably damaging	Het
Zbed3	A	G	13: 95,336,107	D13G	possibly damaging	Het
Zdhhc25	T	A	15: 88,600,759	L99Q	probably benign	Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
PIT4354001:Rgl2	UTSW	17	33933940	missense	possibly damaging	0.80
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R1961:Rgl2	UTSW	17	33933615	missense	probably damaging	1.00
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R6867:Rgl2	UTSW	17	33932687	missense	probably benign	0.09
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7282:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7901:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGTTCAACAAGGTGGCG -3'
(R):5'- AACAGGCCTCTGAGCACAAG -3'

Sequencing Primer
(F):5'- GGGGCCACCTCAATTGGAG -3'
(R):5'- TCTGAGCACAAGCCTGGC -3'

Posted On

2014-09-18