Incidental Mutation 'R0179:Tdp2'
ID23064
Institutional Source Beutler Lab
Gene Symbol Tdp2
Ensembl Gene ENSMUSG00000035958
Gene Nametyrosyl-DNA phosphodiesterase 2
SynonymsD13Ertd656e, Ttrap
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R0179 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location24831679-24842153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24840448 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 243 (H243Y)
Ref Sequence ENSEMBL: ENSMUSP00000035660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000038039] [ENSMUST00000141572] [ENSMUST00000225138]
PDB Structure
Mus Musculus Tdp2 Bound to dAMP and Mg2+ [X-RAY DIFFRACTION]
Mus Musculus Tdp2-DNA Substrate Analog (5'-6-aminohexanol) Complex [X-RAY DIFFRACTION]
Mus Musculus Tdp2 reaction product (5'-phosphorylated DNA)-Mg2+ complex at 1.5 Angstroms resolution [X-RAY DIFFRACTION]
Mus Musculus Tdp2 excluded ssDNA complex [X-RAY DIFFRACTION]
Mus Musculus Tdp2 reaction product complex with 5'-phosphorylated RNA/DNA, glycerol, and Mg2+ [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006893
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038039
AA Change: H243Y

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035660
Gene: ENSMUSG00000035958
AA Change: H243Y

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:Exo_endo_phos 127 359 3.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130788
Predicted Effect probably benign
Transcript: ENSMUST00000141572
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224542
Predicted Effect probably benign
Transcript: ENSMUST00000225138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226055
Meta Mutation Damage Score 0.1265 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a superfamily of divalent cation-dependent phosphodiesterases. The encoded protein associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor associated factors (TRAFs), and inhibits nuclear factor-kappa-B activation. This protein has sequence and structural similarities with APE1 endonuclease, which is involved in both DNA repair and the activation of transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice carrying a gene trap insertion into intron 5 but subsequently shown to harbor a partial duplication of the wild-type allele at the ES cell level are born with a normal Mendelian distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Tdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Tdp2 APN 13 24840538 missense probably damaging 1.00
IGL01376:Tdp2 APN 13 24836949 splice site probably null
IGL02346:Tdp2 APN 13 24841352 missense possibly damaging 0.86
IGL02455:Tdp2 APN 13 24841262 missense probably damaging 0.97
R0008:Tdp2 UTSW 13 24841350 splice site probably null
R0008:Tdp2 UTSW 13 24841350 splice site probably null
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R0164:Tdp2 UTSW 13 24838239 missense probably damaging 1.00
R1939:Tdp2 UTSW 13 24841277 missense probably benign 0.07
R3807:Tdp2 UTSW 13 24831793 nonsense probably null
R3955:Tdp2 UTSW 13 24836099 missense probably benign 0.00
R4943:Tdp2 UTSW 13 24838265 missense probably benign 0.02
R5044:Tdp2 UTSW 13 24831826 missense probably benign 0.00
R5529:Tdp2 UTSW 13 24838236 nonsense probably null
R5827:Tdp2 UTSW 13 24831853 missense probably damaging 0.99
R6235:Tdp2 UTSW 13 24840395 nonsense probably null
R6326:Tdp2 UTSW 13 24840557 missense probably damaging 1.00
R7091:Tdp2 UTSW 13 24838224 missense probably damaging 1.00
R7244:Tdp2 UTSW 13 24841301 missense probably benign 0.02
R7341:Tdp2 UTSW 13 24832076 missense probably benign 0.00
R8010:Tdp2 UTSW 13 24836027 missense probably damaging 1.00
Z1177:Tdp2 UTSW 13 24841251 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACCTTCTGCTCTTCATTTAGGAACA -3'
(R):5'- CAGGGATGCTACAAATACCCTCAACTTT -3'

Sequencing Primer
(F):5'- TTAGTGGTCAGTGGCCAGTT -3'
(R):5'- AGGATTTCTCCTAATAGCTTTTGTGC -3'
Posted On2013-04-16