Mutagenetix > Incidental Mutations

Incidental Mutation 'R0179:Washc5'

23068

Institutional Source

Beutler Lab

Gene Symbol

Washc5

Ensembl Gene

ENSMUSG00000022350

Gene Name

WASH complex subunit 5

Synonyms

E430025E21Rik, strumpellin

MMRRC Submission

038447-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R0179 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

59331997-59374167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59352530 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 460 (V460A)

Ref Sequence

ENSEMBL: ENSMUSP00000022976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]

Predicted Effect

probably benign
Transcript: ENSMUST00000022976
AA Change: V460A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: V460A

Domain	Start	End	E-Value	Type
Pfam:Strumpellin	23	1103	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000227725

Meta Mutation Damage Score

0.2410

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.1%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,214	S516P	probably benign	Het
4932431P20Rik	A	G	7: 29,535,940		noncoding transcript	Het
Adamts1	C	T	16: 85,795,465	S948N	probably benign	Het
Adck1	A	T	12: 88,459,172	M457L	possibly damaging	Het
Adprm	A	T	11: 67,038,225	H313Q	possibly damaging	Het
Adssl1	T	C	12: 112,632,269	I104T	probably benign	Het
Agxt2	A	C	15: 10,399,048	Q435P	possibly damaging	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Ankrd50	A	G	3: 38,455,314	V968A	possibly damaging	Het
Brf2	T	C	8: 27,125,868	D163G	possibly damaging	Het
Cd226	C	A	18: 89,207,139	N53K	probably benign	Het
Cdc42ep2	T	C	19: 5,918,608	D23G	probably benign	Het
Cdc7	T	C	5: 106,965,039	S8P	probably benign	Het
Cdh8	C	T	8: 99,111,712	E499K	possibly damaging	Het
Chd7	T	A	4: 8,862,516	F2534L	probably benign	Het
Ckb	T	C	12: 111,670,176	T255A	probably benign	Het
Cntnap5c	G	T	17: 57,769,625	W19L	probably benign	Het
Cntrl	A	G	2: 35,167,859	E1854G	probably benign	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cop1	A	G	1: 159,250,066	D157G	probably benign	Het
Csf2rb	A	C	15: 78,336,372	Q38P	possibly damaging	Het
Ctla2b	T	C	13: 60,896,293	D52G	possibly damaging	Het
Dcaf7	A	T	11: 106,051,797	D190V	probably damaging	Het
Depdc5	T	A	5: 32,901,574		probably benign	Het
Dgkq	A	G	5: 108,658,200		probably benign	Het
Dhrs2	A	G	14: 55,240,476	T222A	probably damaging	Het
Dock1	G	A	7: 135,098,837	D1109N	probably damaging	Het
E4f1	G	C	17: 24,451,437	T92S	possibly damaging	Het
Ep400	A	T	5: 110,668,649	S2669T	probably damaging	Het
Eprs	T	G	1: 185,413,547	D1184E	probably benign	Het
Fpr-rs4	A	T	17: 18,022,027	K99*	probably null	Het
Fzr1	A	T	10: 81,369,070		probably benign	Het
Gcc2	C	T	10: 58,276,650	R1001C	probably benign	Het
Gm4884	A	G	7: 41,043,828	D407G	probably benign	Het
Golga4	A	T	9: 118,560,740		probably null	Het
Gp2	T	G	7: 119,452,317	D225A	possibly damaging	Het
Gramd1a	T	A	7: 31,142,418	T120S	probably damaging	Het
Hbb-bh2	T	A	7: 103,839,227	N121I	probably benign	Het
Htr6	A	T	4: 139,062,126	L276Q	probably damaging	Het
Itga9	A	T	9: 118,661,386	I262F	probably benign	Het
Lamc3	A	G	2: 31,915,084		probably benign	Het
Large1	T	C	8: 73,098,846	N200S	probably benign	Het
Lct	C	T	1: 128,327,685	V207I	probably benign	Het
Marf1	C	A	16: 14,151,176	L144F	probably damaging	Het
Morc2b	A	T	17: 33,136,982	Y605*	probably null	Het
Mtus1	G	T	8: 41,002,361	L87I	possibly damaging	Het
Muc2	A	G	7: 141,748,971	Y17C	probably damaging	Het
Myf5	T	C	10: 107,485,918	D5G	possibly damaging	Het
Nasp	C	T	4: 116,602,157	V375M	probably damaging	Het
Nr1h2	A	T	7: 44,552,265		probably null	Het
Nrg2	T	C	18: 36,022,415	Q447R	probably benign	Het
Ntn5	G	A	7: 45,686,313	G56D	probably damaging	Het
Oasl2	A	G	5: 114,910,912	R138G	probably benign	Het
Olfr1209	A	T	2: 88,909,893	C167S	possibly damaging	Het
Olfr1489	T	A	19: 13,633,140	F10I	probably damaging	Het
Olfr827	T	C	10: 130,210,338	Y264C	probably damaging	Het
Pcdhb5	G	A	18: 37,322,559	G664D	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,000	E128G	probably damaging	Het
Prpf19	T	C	19: 10,897,808		probably benign	Het
Ptpn3	T	A	4: 57,270,118	T15S	probably benign	Het
R3hdm2	G	A	10: 127,495,106	C818Y	probably damaging	Het
Rad51d	A	G	11: 82,889,998	V39A	possibly damaging	Het
Rptor	A	T	11: 119,872,367	T926S	probably benign	Het
Rwdd4a	G	A	8: 47,542,707	D41N	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Ssbp3	T	C	4: 107,046,388	S334P	probably damaging	Het
Suco	A	G	1: 161,876,305		probably benign	Het
Synj1	T	C	16: 90,964,631	K649R	possibly damaging	Het
Tdp2	C	T	13: 24,840,448	H243Y	possibly damaging	Het
Tinag	A	G	9: 76,996,882		probably benign	Het
Trerf1	T	C	17: 47,316,662		noncoding transcript	Het
Trip10	T	C	17: 57,262,349		probably benign	Het
Tsen54	A	T	11: 115,822,030	S131C	probably damaging	Het
Unc5c	A	T	3: 141,818,067	R794*	probably null	Het
Vmn2r59	A	T	7: 42,047,008	Y103*	probably null	Het
Whamm	A	G	7: 81,594,015	T358A	probably benign	Het
Xlr4b	C	T	X: 73,218,671		probably benign	Het
Zbbx	C	T	3: 75,085,562		probably benign	Het
Zdhhc23	G	A	16: 43,973,703	P203S	probably benign	Het
Zfp27	T	A	7: 29,896,425	E38D	possibly damaging	Het

Other mutations in Washc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Washc5	APN	15	59337276	missense	probably damaging	0.99
IGL01096:Washc5	APN	15	59350211	splice site	probably benign
IGL01305:Washc5	APN	15	59355839	nonsense	probably null
IGL01707:Washc5	APN	15	59342015	missense	possibly damaging	0.89
IGL01921:Washc5	APN	15	59342109	splice site	probably null
IGL02056:Washc5	APN	15	59350336	missense	possibly damaging	0.63
IGL02145:Washc5	APN	15	59369211	missense	probably benign
IGL02430:Washc5	APN	15	59366291	missense	probably damaging	1.00
IGL02450:Washc5	APN	15	59332317	nonsense	probably null
IGL03238:Washc5	APN	15	59346842	missense	probably damaging	1.00
IGL03351:Washc5	APN	15	59363350	splice site	probably benign
ANU22:Washc5	UTSW	15	59355839	nonsense	probably null
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0265:Washc5	UTSW	15	59338960	missense	probably benign	0.43
R0315:Washc5	UTSW	15	59341976	missense	probably damaging	1.00
R0545:Washc5	UTSW	15	59342093	missense	possibly damaging	0.50
R0611:Washc5	UTSW	15	59341158	missense	probably damaging	0.99
R0636:Washc5	UTSW	15	59359409	missense	probably benign	0.01
R1006:Washc5	UTSW	15	59369186	missense	probably benign	0.21
R1006:Washc5	UTSW	15	59369187	missense	probably benign	0.06
R1237:Washc5	UTSW	15	59338908	splice site	probably benign
R1835:Washc5	UTSW	15	59359340	missense	possibly damaging	0.86
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R2005:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2006:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2060:Washc5	UTSW	15	59350408	missense	probably damaging	1.00
R2134:Washc5	UTSW	15	59369234	missense	probably damaging	1.00
R2139:Washc5	UTSW	15	59350142	missense	probably damaging	1.00
R2177:Washc5	UTSW	15	59363269	nonsense	probably null
R2975:Washc5	UTSW	15	59345358	missense	probably damaging	1.00
R4088:Washc5	UTSW	15	59339862	missense	probably damaging	1.00
R4824:Washc5	UTSW	15	59333636	nonsense	probably null
R4843:Washc5	UTSW	15	59350371	missense	possibly damaging	0.95
R4991:Washc5	UTSW	15	59344080	missense	probably damaging	1.00
R4996:Washc5	UTSW	15	59333635	missense	probably benign
R5103:Washc5	UTSW	15	59350169	missense	probably damaging	1.00
R5312:Washc5	UTSW	15	59345528	splice site	probably null
R5591:Washc5	UTSW	15	59369163	missense	probably damaging	1.00
R6073:Washc5	UTSW	15	59335170	missense	possibly damaging	0.90
R6123:Washc5	UTSW	15	59335110	missense	probably damaging	1.00
R6156:Washc5	UTSW	15	59345399	missense	probably damaging	1.00
R6292:Washc5	UTSW	15	59355934	missense	probably damaging	1.00
R6297:Washc5	UTSW	15	59344046	missense	possibly damaging	0.61
R6374:Washc5	UTSW	15	59337195	missense	probably benign	0.14
R6659:Washc5	UTSW	15	59340890	critical splice donor site	probably null
R6880:Washc5	UTSW	15	59350172	missense	probably benign	0.00
R7146:Washc5	UTSW	15	59352501	nonsense	probably null
R7330:Washc5	UTSW	15	59333667	missense	probably benign	0.02
R7430:Washc5	UTSW	15	59369913	nonsense	probably null
R7490:Washc5	UTSW	15	59337204	missense	probably benign	0.18
R7532:Washc5	UTSW	15	59367411	missense	possibly damaging	0.46
R7560:Washc5	UTSW	15	59366192	missense	probably damaging	0.97
R7803:Washc5	UTSW	15	59368459	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAACACGTCAGAACTGTGAGGTACAA -3'
(R):5'- GCTTTCTCTGAGCCACCTGCCTA -3'

Sequencing Primer
(F):5'- cacccacacctccacac -3'
(R):5'- gccccttacccacttagcc -3'

Posted On

2013-04-16