Incidental Mutation 'R2103:Hhipl1'
ID230717
Institutional Source Beutler Lab
Gene Symbol Hhipl1
Ensembl Gene ENSMUSG00000021260
Gene Namehedgehog interacting protein-like 1
Synonyms
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2103 (G1)
Quality Score134
Status Not validated
Chromosome12
Chromosomal Location108306270-108330869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108327718 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 628 (T628A)
Ref Sequence ENSEMBL: ENSMUSP00000021685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021685]
Predicted Effect probably benign
Transcript: ENSMUST00000021685
AA Change: T628A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021685
Gene: ENSMUSG00000021260
AA Change: T628A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Folate_rec 28 189 2.4e-21 PFAM
Pfam:GSDH 199 532 3e-39 PFAM
low complexity region 619 670 N/A INTRINSIC
SR 682 785 2.01e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223395
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glucose/sorbosone dehydrogenase family. The encoded protein also contains a domain that binds folate and reduced folic acid derivatives. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Hhipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
lemon_drops UTSW 12 108311944 missense probably damaging 1.00
Rock_candy UTSW 12 108311689 missense probably damaging 1.00
R0091:Hhipl1 UTSW 12 108321897 splice site probably benign
R0180:Hhipl1 UTSW 12 108328070 missense probably damaging 1.00
R0610:Hhipl1 UTSW 12 108319402 nonsense probably null
R0962:Hhipl1 UTSW 12 108327721 missense probably benign 0.02
R1170:Hhipl1 UTSW 12 108311693 nonsense probably null
R1474:Hhipl1 UTSW 12 108311737 missense probably damaging 1.00
R1878:Hhipl1 UTSW 12 108320060 missense possibly damaging 0.93
R2001:Hhipl1 UTSW 12 108321859 missense possibly damaging 0.90
R2132:Hhipl1 UTSW 12 108311690 missense probably damaging 1.00
R2342:Hhipl1 UTSW 12 108318462 missense probably damaging 1.00
R2408:Hhipl1 UTSW 12 108318547 missense probably benign 0.05
R3431:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3432:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3741:Hhipl1 UTSW 12 108318717 missense probably damaging 1.00
R3802:Hhipl1 UTSW 12 108312307 missense probably benign
R4744:Hhipl1 UTSW 12 108319979 missense possibly damaging 0.95
R4760:Hhipl1 UTSW 12 108320077 missense probably damaging 0.99
R4927:Hhipl1 UTSW 12 108311944 missense probably damaging 1.00
R5206:Hhipl1 UTSW 12 108312178 missense probably damaging 1.00
R5244:Hhipl1 UTSW 12 108312134 missense probably damaging 0.99
R5292:Hhipl1 UTSW 12 108327778 missense probably benign
R5445:Hhipl1 UTSW 12 108328208 missense probably damaging 0.97
R6248:Hhipl1 UTSW 12 108318705 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTGGCTCCCTAAGATG -3'
(R):5'- TATGAACACTTCCACGCGAC -3'

Sequencing Primer
(F):5'- TGGCTCCCTAAGATGCACCC -3'
(R):5'- TGCGGGCCGTACCAGAC -3'
Posted On2014-09-18