Incidental Mutation 'R0179:Synj1'
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Namesynaptojanin 1
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0179 (G1)
Quality Score225
Status Validated (trace)
Chromosomal Location90936092-91011308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90964631 bp
Amino Acid Change Lysine to Arginine at position 649 (K649R)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853] [ENSMUST00000231472]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118246
Predicted Effect unknown
Transcript: ENSMUST00000118390
AA Change: K623R
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: K623R

low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121759
AA Change: K649R

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: K649R

low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130813
AA Change: K604R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973
AA Change: K604R

Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170853
AA Change: K609R

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: K609R

Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231472
Meta Mutation Damage Score 0.1179 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Pcdhb5 G A 18: 37,322,559 G664D probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90951976 missense probably damaging 1.00
IGL01468:Synj1 APN 16 91010172 splice site probably benign
IGL02209:Synj1 APN 16 90987419 missense probably damaging 0.97
IGL02452:Synj1 APN 16 90961365 splice site probably benign
IGL02619:Synj1 APN 16 90974045 missense probably damaging 1.00
IGL02650:Synj1 APN 16 90976696 missense probably benign 0.03
IGL02708:Synj1 APN 16 90991462 missense probably damaging 1.00
IGL02863:Synj1 APN 16 90961434 missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90988168 missense probably damaging 0.99
IGL03295:Synj1 APN 16 90938430 missense probably benign 0.14
IGL03356:Synj1 APN 16 90987392 missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90964508 missense probably damaging 1.00
R0396:Synj1 UTSW 16 90938640 missense probably benign
R0426:Synj1 UTSW 16 90967354 missense probably damaging 1.00
R0486:Synj1 UTSW 16 90938263 utr 3 prime probably benign
R0515:Synj1 UTSW 16 90994022 missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90948087 missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0698:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0945:Synj1 UTSW 16 90960445 missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90946855 missense probably benign 0.05
R1562:Synj1 UTSW 16 90987402 missense probably benign 0.09
R1732:Synj1 UTSW 16 90964230 missense probably damaging 0.99
R1752:Synj1 UTSW 16 90938473 missense probably benign
R1785:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R1786:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R2011:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2012:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2065:Synj1 UTSW 16 90991649 critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90969329 missense probably damaging 1.00
R3026:Synj1 UTSW 16 90978734 missense probably damaging 1.00
R3151:Synj1 UTSW 16 90960626 missense probably damaging 0.96
R3946:Synj1 UTSW 16 91010096 missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90991603 missense probably damaging 1.00
R4472:Synj1 UTSW 16 90969181 critical splice donor site probably null
R4547:Synj1 UTSW 16 90988282 missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90973989 missense probably damaging 1.00
R4739:Synj1 UTSW 16 90955419 missense probably benign 0.00
R5027:Synj1 UTSW 16 90940519 splice site probably null
R5428:Synj1 UTSW 16 90991518 missense probably damaging 0.98
R5586:Synj1 UTSW 16 91009977 intron probably benign
R5769:Synj1 UTSW 16 90938253 utr 3 prime probably benign
R6005:Synj1 UTSW 16 90969286 missense probably damaging 1.00
R6119:Synj1 UTSW 16 90938989 missense probably benign 0.30
R6313:Synj1 UTSW 16 90946815 missense probably benign 0.00
R6324:Synj1 UTSW 16 90938630 missense probably benign 0.00
R6549:Synj1 UTSW 16 90938677 missense probably benign
R6696:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6698:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6861:Synj1 UTSW 16 90963880 nonsense probably null
R7008:Synj1 UTSW 16 90993945 missense probably damaging 1.00
R7153:Synj1 UTSW 16 90948090 missense probably benign 0.04
R7393:Synj1 UTSW 16 90951999 missense probably damaging 0.99
R7510:Synj1 UTSW 16 90938677 missense probably benign
R7560:Synj1 UTSW 16 90940483 missense probably benign
R7724:Synj1 UTSW 16 90961499 missense probably damaging 0.99
R7913:Synj1 UTSW 16 90991427 missense possibly damaging 0.83
R8326:Synj1 UTSW 16 90988196 missense probably benign 0.12
Z1176:Synj1 UTSW 16 90987340 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtatgtggaggtcagaggatag -3'
Posted On2013-04-16