Incidental Mutation 'R2104:Ugt2a3'
ID230774
Institutional Source Beutler Lab
Gene Symbol Ugt2a3
Ensembl Gene ENSMUSG00000035780
Gene NameUDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms2010321J07Rik
MMRRC Submission 040108-MU
Accession Numbers

Genbank: NM_028094; MGI: 1919344

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87324972-87337195 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 87329682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031195]
Predicted Effect probably null
Transcript: ENSMUST00000031195
SMART Domains Protein: ENSMUSP00000031195
Gene: ENSMUSG00000035780

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:UDPGT 24 526 1.2e-233 PFAM
Pfam:Glyco_tran_28_C 318 454 1.5e-10 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Ugt2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ugt2a3 APN 5 87325655 missense probably damaging 0.99
IGL00542:Ugt2a3 APN 5 87336823 missense possibly damaging 0.61
IGL01335:Ugt2a3 APN 5 87336785 missense probably damaging 1.00
IGL01369:Ugt2a3 APN 5 87327120 missense probably damaging 1.00
IGL01808:Ugt2a3 APN 5 87325555 missense probably benign 0.09
IGL02380:Ugt2a3 APN 5 87336799 missense probably benign 0.09
IGL03245:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03260:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03261:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03280:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
IGL03302:Ugt2a3 APN 5 87336580 missense probably damaging 1.00
D4186:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R0051:Ugt2a3 UTSW 5 87337006 missense probably damaging 1.00
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0103:Ugt2a3 UTSW 5 87336718 missense possibly damaging 0.89
R0324:Ugt2a3 UTSW 5 87327073 critical splice donor site probably null
R0401:Ugt2a3 UTSW 5 87336490 missense probably benign 0.03
R0506:Ugt2a3 UTSW 5 87336649 missense possibly damaging 0.78
R0903:Ugt2a3 UTSW 5 87327711 missense probably benign 0.00
R0940:Ugt2a3 UTSW 5 87327206 missense possibly damaging 0.95
R1121:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R1296:Ugt2a3 UTSW 5 87327146 missense probably damaging 0.96
R1527:Ugt2a3 UTSW 5 87325598 missense probably damaging 1.00
R2119:Ugt2a3 UTSW 5 87336571 missense probably damaging 0.98
R2374:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R3082:Ugt2a3 UTSW 5 87325675 missense probably benign 0.05
R3853:Ugt2a3 UTSW 5 87337159 missense possibly damaging 0.74
R3894:Ugt2a3 UTSW 5 87329590 missense probably benign 0.09
R4063:Ugt2a3 UTSW 5 87336866 missense probably benign 0.04
R4274:Ugt2a3 UTSW 5 87327689 missense probably damaging 0.99
R4739:Ugt2a3 UTSW 5 87327195 missense probably damaging 0.97
R4879:Ugt2a3 UTSW 5 87331285 missense probably benign 0.06
R5327:Ugt2a3 UTSW 5 87331315 missense probably damaging 1.00
R5508:Ugt2a3 UTSW 5 87327200 missense probably damaging 0.98
R5866:Ugt2a3 UTSW 5 87336547 missense probably damaging 1.00
R6026:Ugt2a3 UTSW 5 87336477 missense probably benign 0.00
R6268:Ugt2a3 UTSW 5 87329613 missense probably damaging 1.00
R6807:Ugt2a3 UTSW 5 87336758 missense probably benign 0.00
R6980:Ugt2a3 UTSW 5 87325632 missense probably damaging 1.00
R7056:Ugt2a3 UTSW 5 87337094 missense probably damaging 0.98
R7133:Ugt2a3 UTSW 5 87325534 missense possibly damaging 0.61
R7477:Ugt2a3 UTSW 5 87336620 missense possibly damaging 0.90
R7485:Ugt2a3 UTSW 5 87327680 critical splice donor site probably null
R7798:Ugt2a3 UTSW 5 87327723 missense probably damaging 1.00
R7957:Ugt2a3 UTSW 5 87327191 missense probably damaging 1.00
R8803:Ugt2a3 UTSW 5 87336530 missense probably damaging 0.98
R8886:Ugt2a3 UTSW 5 87336499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCTAAGCTGGTGTGCTC -3'
(R):5'- TCAGTGATGGCTTTCACCAG -3'

Sequencing Primer
(F):5'- GTGCTCCCCAGGATCTCACAAG -3'
(R):5'- GGCTTTCACCAGTTTTGAAAATGCAG -3'
Posted On2014-09-18