Incidental Mutation 'R2104:Wdr81'
ID230806
Institutional Source Beutler Lab
Gene Symbol Wdr81
Ensembl Gene ENSMUSG00000045374
Gene NameWD repeat domain 81
SynonymsMGC32441
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75440944-75454717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75452983 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 486 (P486Q)
Ref Sequence ENSEMBL: ENSMUSP00000134266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173320]
Predicted Effect unknown
Transcript: ENSMUST00000117392
AA Change: P485Q
SMART Domains Protein: ENSMUSP00000113939
Gene: ENSMUSG00000045374
AA Change: P485Q

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132442
SMART Domains Protein: ENSMUSP00000120605
Gene: ENSMUSG00000045374

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 23 47 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
WD40 512 551 3.19e-7 SMART
WD40 561 598 1.18e2 SMART
WD40 601 670 3.55e1 SMART
Blast:WD40 673 710 3e-14 BLAST
WD40 715 756 4.26e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135804
Predicted Effect probably damaging
Transcript: ENSMUST00000173320
AA Change: P486Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134266
Gene: ENSMUSG00000045374
AA Change: P486Q

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Meta Mutation Damage Score 0.3316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit weight loss, tremors, ataxia and an abnormal gait, as well as abnormal mitochondria in Purkinje cell dendrites, Purkinje cell degeneration, photoreceptor cell loss, and decreased total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Wdr81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Wdr81 APN 11 75445601 missense probably damaging 1.00
IGL02047:Wdr81 APN 11 75445506 missense probably damaging 1.00
IGL02103:Wdr81 APN 11 75444720 missense probably damaging 1.00
IGL02506:Wdr81 APN 11 75444406 missense probably benign 0.44
jello UTSW 11 75441812 missense probably damaging 1.00
R1184:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R1560:Wdr81 UTSW 11 75451623 nonsense probably null
R1680:Wdr81 UTSW 11 75454423 missense probably benign
R1689:Wdr81 UTSW 11 75445596 missense probably damaging 0.99
R2021:Wdr81 UTSW 11 75445962 nonsense probably null
R2113:Wdr81 UTSW 11 75453635 missense probably benign 0.07
R2198:Wdr81 UTSW 11 75446081 missense probably benign 0.00
R2393:Wdr81 UTSW 11 75449405 missense probably damaging 1.00
R2400:Wdr81 UTSW 11 75449035 missense probably benign
R2850:Wdr81 UTSW 11 75451172 missense probably damaging 1.00
R3410:Wdr81 UTSW 11 75452932 missense probably damaging 0.97
R3764:Wdr81 UTSW 11 75452803 missense probably damaging 1.00
R4223:Wdr81 UTSW 11 75448002 missense probably benign 0.00
R4351:Wdr81 UTSW 11 75441812 missense probably damaging 1.00
R4594:Wdr81 UTSW 11 75445794 missense probably benign 0.00
R4601:Wdr81 UTSW 11 75445658 missense probably damaging 1.00
R4647:Wdr81 UTSW 11 75445988 missense probably damaging 0.98
R4651:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4652:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4930:Wdr81 UTSW 11 75451924 missense probably benign
R4966:Wdr81 UTSW 11 75445949 missense probably benign 0.34
R5075:Wdr81 UTSW 11 75452481 missense probably benign 0.00
R5412:Wdr81 UTSW 11 75450794 missense probably null 1.00
R5426:Wdr81 UTSW 11 75450896 missense possibly damaging 0.87
R5540:Wdr81 UTSW 11 75449070 missense probably damaging 1.00
R5544:Wdr81 UTSW 11 75441797 missense probably damaging 1.00
R5632:Wdr81 UTSW 11 75445906 missense probably damaging 0.99
R5650:Wdr81 UTSW 11 75444748 missense probably damaging 1.00
R5679:Wdr81 UTSW 11 75452923 missense probably damaging 1.00
R5978:Wdr81 UTSW 11 75444398 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6412:Wdr81 UTSW 11 75451163 missense probably benign 0.16
R6479:Wdr81 UTSW 11 75452105 missense possibly damaging 0.92
R6992:Wdr81 UTSW 11 75451786 missense probably benign 0.00
R7148:Wdr81 UTSW 11 75446002 missense
R7340:Wdr81 UTSW 11 75444699 missense probably null
R7739:Wdr81 UTSW 11 75441985 missense
R7823:Wdr81 UTSW 11 75449801 missense probably damaging 1.00
R7898:Wdr81 UTSW 11 75453899 missense probably benign
R7981:Wdr81 UTSW 11 75453899 missense probably benign
Z1176:Wdr81 UTSW 11 75449885 missense
Z1176:Wdr81 UTSW 11 75451947 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGATCAATCCAGTGATGCAGG -3'
(R):5'- TTCACCTATGAGATGACCCGG -3'

Sequencing Primer
(F):5'- ATCAATCCAGTGATGCAGGTCTTG -3'
(R):5'- ATGACCCGGCAGGCATTTG -3'
Posted On2014-09-18