Incidental Mutation 'R2105:Nckap5'
ID 230834
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene Name NCK-associated protein 5
Synonyms LOC380609, D130011D22Rik, E030049G20Rik
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 125841373-126758529 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 125954255 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 766 (I766F)
Ref Sequence ENSEMBL: ENSMUSP00000125624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000161954] [ENSMUST00000162877]
AlphaFold E9QAE1
Predicted Effect possibly damaging
Transcript: ENSMUST00000057846
AA Change: I702F

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690
AA Change: I702F

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112583
AA Change: I834F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690
AA Change: I834F

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159934
Predicted Effect probably damaging
Transcript: ENSMUST00000161954
AA Change: I766F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690
AA Change: I766F

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or5w11 A G 2: 87,459,283 (GRCm39) T159A probably benign Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 125,954,889 (GRCm39) missense probably damaging 0.99
IGL00956:Nckap5 APN 1 125,952,755 (GRCm39) missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126,456,450 (GRCm39) missense probably damaging 1.00
IGL01482:Nckap5 APN 1 125,950,897 (GRCm39) missense probably damaging 1.00
IGL01508:Nckap5 APN 1 125,953,309 (GRCm39) missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125,909,305 (GRCm39) missense probably damaging 0.97
IGL02129:Nckap5 APN 1 125,955,432 (GRCm39) nonsense probably null
IGL02821:Nckap5 APN 1 125,955,553 (GRCm39) missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125,909,383 (GRCm39) missense probably damaging 1.00
F5493:Nckap5 UTSW 1 125,953,564 (GRCm39) missense probably benign
G5030:Nckap5 UTSW 1 125,953,591 (GRCm39) missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125,867,979 (GRCm39) intron probably benign
R0164:Nckap5 UTSW 1 125,952,144 (GRCm39) missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 125,952,144 (GRCm39) missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 125,954,171 (GRCm39) missense probably benign
R0482:Nckap5 UTSW 1 125,954,102 (GRCm39) missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125,909,121 (GRCm39) splice site probably null
R0541:Nckap5 UTSW 1 126,623,459 (GRCm39) missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 125,955,025 (GRCm39) nonsense probably null
R0701:Nckap5 UTSW 1 125,953,094 (GRCm39) missense probably benign 0.06
R0782:Nckap5 UTSW 1 125,909,278 (GRCm39) missense probably damaging 1.00
R1389:Nckap5 UTSW 1 125,954,447 (GRCm39) missense probably damaging 0.99
R1401:Nckap5 UTSW 1 125,942,398 (GRCm39) splice site probably benign
R1436:Nckap5 UTSW 1 125,953,798 (GRCm39) missense possibly damaging 0.96
R1506:Nckap5 UTSW 1 125,953,650 (GRCm39) nonsense probably null
R1528:Nckap5 UTSW 1 125,952,659 (GRCm39) missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 125,952,039 (GRCm39) missense probably damaging 1.00
R1968:Nckap5 UTSW 1 125,942,367 (GRCm39) missense probably damaging 0.99
R2055:Nckap5 UTSW 1 125,954,635 (GRCm39) missense probably damaging 1.00
R2214:Nckap5 UTSW 1 125,953,487 (GRCm39) missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126,456,489 (GRCm39) missense probably damaging 1.00
R2403:Nckap5 UTSW 1 125,955,146 (GRCm39) missense probably benign 0.18
R2430:Nckap5 UTSW 1 125,842,494 (GRCm39) missense probably damaging 0.99
R2914:Nckap5 UTSW 1 125,954,274 (GRCm39) splice site probably null
R3782:Nckap5 UTSW 1 125,952,811 (GRCm39) missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126,150,443 (GRCm39) missense probably benign 0.13
R4249:Nckap5 UTSW 1 125,955,376 (GRCm39) missense probably benign 0.01
R4448:Nckap5 UTSW 1 125,953,463 (GRCm39) nonsense probably null
R4456:Nckap5 UTSW 1 125,842,472 (GRCm39) unclassified probably benign
R4682:Nckap5 UTSW 1 126,030,279 (GRCm39) critical splice donor site probably null
R4817:Nckap5 UTSW 1 125,954,952 (GRCm39) missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 125,953,889 (GRCm39) missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 125,955,324 (GRCm39) missense probably damaging 1.00
R4924:Nckap5 UTSW 1 125,954,765 (GRCm39) nonsense probably null
R4926:Nckap5 UTSW 1 126,456,378 (GRCm39) intron probably benign
R5032:Nckap5 UTSW 1 125,904,786 (GRCm39) missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 125,961,697 (GRCm39) missense probably benign 0.01
R5197:Nckap5 UTSW 1 126,150,410 (GRCm39) missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 125,955,461 (GRCm39) missense probably damaging 0.96
R5257:Nckap5 UTSW 1 125,952,245 (GRCm39) missense probably damaging 0.99
R5277:Nckap5 UTSW 1 125,954,277 (GRCm39) nonsense probably null
R5512:Nckap5 UTSW 1 125,955,481 (GRCm39) missense possibly damaging 0.63
R5700:Nckap5 UTSW 1 125,904,662 (GRCm39) critical splice donor site probably null
R5789:Nckap5 UTSW 1 125,955,439 (GRCm39) missense probably damaging 1.00
R6029:Nckap5 UTSW 1 125,953,523 (GRCm39) missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 125,952,667 (GRCm39) missense probably benign
R6292:Nckap5 UTSW 1 125,842,752 (GRCm39) missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126,309,909 (GRCm39) missense probably damaging 1.00
R6875:Nckap5 UTSW 1 125,950,931 (GRCm39) missense probably benign 0.03
R7017:Nckap5 UTSW 1 126,030,398 (GRCm39) missense probably damaging 1.00
R7018:Nckap5 UTSW 1 125,952,785 (GRCm39) missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126,186,449 (GRCm39) splice site probably null
R7204:Nckap5 UTSW 1 125,954,104 (GRCm39) missense probably benign
R7336:Nckap5 UTSW 1 125,953,786 (GRCm39) missense probably benign 0.00
R7544:Nckap5 UTSW 1 125,953,948 (GRCm39) missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 125,954,270 (GRCm39) missense probably benign 0.00
R7684:Nckap5 UTSW 1 125,954,594 (GRCm39) missense probably benign 0.00
R7749:Nckap5 UTSW 1 125,952,383 (GRCm39) missense probably damaging 1.00
R7773:Nckap5 UTSW 1 125,954,581 (GRCm39) missense probably benign 0.00
R7813:Nckap5 UTSW 1 125,953,163 (GRCm39) missense probably benign 0.10
R7970:Nckap5 UTSW 1 125,952,758 (GRCm39) nonsense probably null
R7992:Nckap5 UTSW 1 125,954,547 (GRCm39) missense probably damaging 0.99
R8278:Nckap5 UTSW 1 125,955,509 (GRCm39) missense probably damaging 1.00
R8373:Nckap5 UTSW 1 125,954,032 (GRCm39) missense probably benign 0.02
R8414:Nckap5 UTSW 1 125,942,357 (GRCm39) missense probably damaging 1.00
R8755:Nckap5 UTSW 1 125,954,279 (GRCm39) missense possibly damaging 0.89
R8845:Nckap5 UTSW 1 125,909,423 (GRCm39) missense possibly damaging 0.80
R9016:Nckap5 UTSW 1 126,623,491 (GRCm39) start codon destroyed probably null 0.01
R9209:Nckap5 UTSW 1 125,867,928 (GRCm39) missense unknown
R9214:Nckap5 UTSW 1 125,942,376 (GRCm39) missense probably benign 0.01
R9300:Nckap5 UTSW 1 125,909,423 (GRCm39) nonsense probably null
R9464:Nckap5 UTSW 1 125,952,494 (GRCm39) missense probably benign 0.00
R9572:Nckap5 UTSW 1 125,955,454 (GRCm39) missense probably benign 0.41
R9721:Nckap5 UTSW 1 125,955,017 (GRCm39) missense probably damaging 0.98
R9748:Nckap5 UTSW 1 125,953,939 (GRCm39) missense probably damaging 1.00
Z1088:Nckap5 UTSW 1 125,952,569 (GRCm39) missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126,456,418 (GRCm39) critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126,150,396 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGACACTGATCTCCCTGGAG -3'
(R):5'- CTTCCAGAGGCAAGTCTTCACC -3'

Sequencing Primer
(F):5'- GGAGACCTCATTCTTGTCTGTG -3'
(R):5'- TTCACCTCAGAAATCCAAACTTGTGG -3'
Posted On 2014-09-18