Incidental Mutation 'R2105:Or5w11'
ID 230839
Institutional Source Beutler Lab
Gene Symbol Or5w11
Ensembl Gene ENSMUSG00000068819
Gene Name olfactory receptor family 5 subfamily W member 11
Synonyms GA_x6K02T2Q125-49133664-49134593, MOR177-4, Olfr1131
MMRRC Submission 040109-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R2105 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 87458809-87459738 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87459283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 159 (T159A)
Ref Sequence ENSEMBL: ENSMUSP00000150754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090712] [ENSMUST00000213302] [ENSMUST00000216082] [ENSMUST00000216756]
AlphaFold Q7TR45
Predicted Effect probably benign
Transcript: ENSMUST00000090712
AA Change: T159A

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088214
Gene: ENSMUSG00000068819
AA Change: T159A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-47 PFAM
Pfam:7tm_1 40 289 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213302
AA Change: T159A

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216082
Predicted Effect probably benign
Transcript: ENSMUST00000216756
AA Change: T43A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,650,459 (GRCm39) P1189L probably benign Het
Acbd4 G A 11: 102,995,265 (GRCm39) D57N probably damaging Het
Acot4 A T 12: 84,085,516 (GRCm39) M78L probably damaging Het
Ago1 A T 4: 126,355,581 (GRCm39) M76K probably benign Het
Agrn G T 4: 156,261,756 (GRCm39) Y511* probably null Het
Arhgef15 A T 11: 68,838,507 (GRCm39) probably null Het
Atp1a3 A T 7: 24,689,278 (GRCm39) M594K probably damaging Het
Atp4a G A 7: 30,419,793 (GRCm39) probably null Het
Bckdk T A 7: 127,506,489 (GRCm39) I272N probably damaging Het
Bod1l A G 5: 41,989,622 (GRCm39) V367A probably benign Het
C1galt1c1 T C X: 37,720,145 (GRCm39) M284V possibly damaging Het
Cenpk T A 13: 104,366,105 (GRCm39) C4* probably null Het
Cfap53 T C 18: 74,416,294 (GRCm39) V9A possibly damaging Het
Chil3 T C 3: 106,067,794 (GRCm39) I124V possibly damaging Het
Creld2 G A 15: 88,704,834 (GRCm39) W103* probably null Het
Cyp2c67 T C 19: 39,614,681 (GRCm39) Y282C probably benign Het
D5Ertd579e C T 5: 36,770,793 (GRCm39) A1201T probably benign Het
Dock4 A G 12: 40,742,988 (GRCm39) H381R probably benign Het
Drc1 C T 5: 30,513,785 (GRCm39) S447F probably benign Het
Fam83g G T 11: 61,594,284 (GRCm39) R606L probably benign Het
Fmnl1 A C 11: 103,085,518 (GRCm39) S688R probably benign Het
Fryl C T 5: 73,279,642 (GRCm39) V219I probably benign Het
Golgb1 T A 16: 36,735,026 (GRCm39) N1424K probably benign Het
Gpr39 T C 1: 125,605,621 (GRCm39) V183A possibly damaging Het
H2-T22 A T 17: 36,351,409 (GRCm39) Y274N probably benign Het
Hif1a T A 12: 73,984,519 (GRCm39) Y313N probably damaging Het
Hip1r T A 5: 124,138,267 (GRCm39) M787K probably damaging Het
Hipk3 T C 2: 104,269,737 (GRCm39) E484G probably damaging Het
Hsh2d T A 8: 72,954,490 (GRCm39) F291I probably benign Het
Ino80 T C 2: 119,262,410 (GRCm39) E692G probably null Het
Itgam T A 7: 127,680,884 (GRCm39) V271D probably damaging Het
Kansl1 A C 11: 104,226,385 (GRCm39) I924S probably damaging Het
Kcnq2 A G 2: 180,723,145 (GRCm39) C628R probably benign Het
Krt78 A C 15: 101,855,849 (GRCm39) V654G possibly damaging Het
Lrit2 A G 14: 36,793,913 (GRCm39) T326A probably damaging Het
Ltk T C 2: 119,582,569 (GRCm39) E710G probably damaging Het
Lysmd1 T C 3: 95,042,285 (GRCm39) L53S probably damaging Het
Mc4r T C 18: 66,992,669 (GRCm39) Y148C probably damaging Het
Mfn2 G A 4: 147,973,162 (GRCm39) Q172* probably null Het
Mknk2 A G 10: 80,504,435 (GRCm39) L242P possibly damaging Het
Mrpl45 A T 11: 97,216,573 (GRCm39) H167L probably benign Het
Myc T C 15: 61,859,951 (GRCm39) V208A probably damaging Het
Myh7b A G 2: 155,471,377 (GRCm39) E1175G probably benign Het
Myo18a A T 11: 77,741,060 (GRCm39) M1456L probably benign Het
Myocd G A 11: 65,109,484 (GRCm39) Q96* probably null Het
Nckap5 T A 1: 125,954,255 (GRCm39) I766F probably damaging Het
Ndst1 T C 18: 60,824,325 (GRCm39) E784G probably benign Het
Nf1 A T 11: 79,360,652 (GRCm39) R1443S possibly damaging Het
Nhlrc3 A G 3: 53,361,072 (GRCm39) W228R probably damaging Het
Nup107 G A 10: 117,609,225 (GRCm39) T378I probably damaging Het
Or14c40 A T 7: 86,313,591 (GRCm39) K240N probably damaging Het
Or1o3 A T 17: 37,573,964 (GRCm39) M197K probably benign Het
Or52d13 T A 7: 103,109,480 (GRCm39) probably null Het
Or5m3b C T 2: 85,871,674 (GRCm39) T5I probably damaging Het
Or6b13 T A 7: 139,782,656 (GRCm39) D9V probably benign Het
Otop1 A G 5: 38,457,801 (GRCm39) D520G probably benign Het
Papln C T 12: 83,827,010 (GRCm39) P712S probably benign Het
Pcbd2 T A 13: 55,880,846 (GRCm39) I34N probably damaging Het
Pkd1l3 T A 8: 110,374,205 (GRCm39) C29* probably null Het
Pou5f1 G A 17: 35,820,899 (GRCm39) V114M probably benign Het
Pramel28 A T 4: 143,692,390 (GRCm39) Y204N probably benign Het
Prpf4b C A 13: 35,068,214 (GRCm39) probably benign Het
Prr23a1 C T 9: 98,724,709 (GRCm39) P24S probably damaging Het
Ptch1 T A 13: 63,693,059 (GRCm39) M65L probably benign Het
Rc3h2 A T 2: 37,289,636 (GRCm39) I392K possibly damaging Het
Reck G T 4: 43,943,195 (GRCm39) D916Y probably damaging Het
Rtf2 A G 2: 172,287,285 (GRCm39) D68G probably damaging Het
Ryr1 G T 7: 28,789,575 (GRCm39) T1513K probably damaging Het
Sacs A G 14: 61,410,890 (GRCm39) D55G possibly damaging Het
Scn9a A G 2: 66,398,527 (GRCm39) S28P probably benign Het
Scrn3 A G 2: 73,160,196 (GRCm39) M280V probably damaging Het
Snx29 C T 16: 11,328,898 (GRCm39) T559I possibly damaging Het
Spn C T 7: 126,735,413 (GRCm39) E109K probably damaging Het
Sra1 C T 18: 36,808,121 (GRCm39) R369H probably benign Het
Srsf11 C T 3: 157,724,982 (GRCm39) A64T probably damaging Het
Stk17b A G 1: 53,815,764 (GRCm39) S12P probably benign Het
Sult1d1 C A 5: 87,707,661 (GRCm39) G153V probably damaging Het
Sycp2 A T 2: 177,991,931 (GRCm39) probably null Het
Tgfb3 T C 12: 86,116,543 (GRCm39) E165G possibly damaging Het
Tns2 C A 15: 102,015,941 (GRCm39) H160N probably benign Het
Ubn1 T A 16: 4,895,088 (GRCm39) C711* probably null Het
Usp13 A T 3: 32,956,135 (GRCm39) D469V probably damaging Het
Vmn1r231 A T 17: 21,110,380 (GRCm39) H178Q possibly damaging Het
Vwa1 A G 4: 155,857,250 (GRCm39) S183P probably damaging Het
Xpo7 A G 14: 70,928,431 (GRCm39) I424T probably benign Het
Zfp109 A G 7: 23,936,041 (GRCm39) probably null Het
Other mutations in Or5w11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Or5w11 APN 2 87,458,973 (GRCm39) missense probably benign 0.03
IGL02186:Or5w11 APN 2 87,459,715 (GRCm39) missense probably benign 0.00
R0266:Or5w11 UTSW 2 87,459,626 (GRCm39) missense possibly damaging 0.79
R0849:Or5w11 UTSW 2 87,459,626 (GRCm39) missense possibly damaging 0.79
R1607:Or5w11 UTSW 2 87,459,321 (GRCm39) missense probably benign 0.14
R2077:Or5w11 UTSW 2 87,459,173 (GRCm39) missense probably damaging 1.00
R2322:Or5w11 UTSW 2 87,459,118 (GRCm39) missense possibly damaging 0.86
R3434:Or5w11 UTSW 2 87,459,418 (GRCm39) missense probably benign 0.02
R4357:Or5w11 UTSW 2 87,458,810 (GRCm39) start codon destroyed probably null 1.00
R5139:Or5w11 UTSW 2 87,459,000 (GRCm39) missense probably benign 0.03
R5333:Or5w11 UTSW 2 87,459,458 (GRCm39) missense probably damaging 0.97
R5719:Or5w11 UTSW 2 87,459,475 (GRCm39) splice site probably null
R6449:Or5w11 UTSW 2 87,459,493 (GRCm39) missense possibly damaging 0.63
R7640:Or5w11 UTSW 2 87,459,436 (GRCm39) missense probably benign 0.01
R7941:Or5w11 UTSW 2 87,459,248 (GRCm39) missense probably benign 0.06
R8110:Or5w11 UTSW 2 87,458,951 (GRCm39) missense possibly damaging 0.75
R8393:Or5w11 UTSW 2 87,459,197 (GRCm39) missense probably damaging 0.97
R8877:Or5w11 UTSW 2 87,459,212 (GRCm39) missense probably damaging 1.00
R9250:Or5w11 UTSW 2 87,459,278 (GRCm39) missense probably benign 0.02
R9290:Or5w11 UTSW 2 87,459,209 (GRCm39) missense probably benign 0.00
R9313:Or5w11 UTSW 2 87,459,076 (GRCm39) missense probably benign 0.03
R9666:Or5w11 UTSW 2 87,459,152 (GRCm39) missense possibly damaging 0.78
X0027:Or5w11 UTSW 2 87,459,647 (GRCm39) missense possibly damaging 0.96
Z1176:Or5w11 UTSW 2 87,459,659 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAGATATGTTTGGCAAGAAC -3'
(R):5'- AAGGACTCCTGAGATGGTGC -3'

Sequencing Primer
(F):5'- GAACAAGTCAATTCCTTTCTGGGGC -3'
(R):5'- TGCTCAGTTCAAGGAAGCC -3'
Posted On 2014-09-18